v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63025 URS00002D6573_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUACAUCUGGCUACUGGGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-222
  2. Callorhinchus milii eshark_mir-221_2
  3. Chrysemys picta cpi-miR-222a-3p
  4. Gadus morhua gmo-miR-222-3p
  5. Gallus gallus Gallus_gallus piRNA piR-gga-217
  6. Mus musculus mmu-miR-222-3p
  7. Pteropus alecto pal-miR-222-3p
  8. Xenopus laevis xla-miR-222-3p
  9. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3436532