Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) mitochondrially encoded tRNA threonine secondary structure diagram

Mus musculus (house mouse) mitochondrially encoded tRNA threonine URS00002D0E0C_10090

  • 67 nucleotides
  • 4 databases (ENA, Ensembl, Ensembl/GENCODE, MGI)
  • Found in 3 species

Automated summary: This tRNA sequence is 67 nucleotides long and is found in Mus musculus. Annotated by 4 databases (Ensembl/GENCODE, MGI, ENA, Ensembl). Described in 20 papers. Has a conserved secondary structure or a structured region. Mus musculus (house mouse) mitochondrially encoded tRNA threonine sequence is a product of mt-TT, mt-Tt, TrnT, trnT, tRNA-Thr genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCUUGAUAGUAUAAACAUUACUCUGGUCUUGUAAACCUGAAAUGAAGAUCUUCUCUUCUCAAGACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Mus musculus domesticus transfer RNA-Thr
    2. Mus musculus helgolandicus tRNA-Thr
    3. Mus musculus musculus tRNA-Thr
    2D structure New