Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhingia louguanensis tRNA-Leu secondary structure diagram

Rhingia louguanensis tRNA-Leu URS00002CF520_3014016

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUAAUAUGGCAGAUUAGUGCAAUAGAUUUAAGCUCUAUAUAUAAAGUAUUUUACUUUUAUUAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Drosophila mauritiana tRNA-Leu
  2. Drosophila melanogaster mitochondrial transfer RNA:Leucine-TAA (Dmel_CR34068)
  3. Drosophila sechellia tRNA-Leu
  4. Drosophila simulans tRNA-Leu
  5. Ferdinandea cuprea tRNA-Leu
  6. Mesembrina meridiana tRNA-Leu
  7. Polietina nigra transfer RNA-Leu
  8. Syrphidae sp. MT-2014 tRNA-Leu
2D structure