v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-34c-3p URS00002C7C59_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUCACUAACCACACGGCCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Capra hircus (goat) chi-miR-34c-3p
  2. Cavia porcellus cpo-miR-34c-3p
  3. Cricetulus griseus (Chinese hamster) cgr-miR-34c-3p
  4. Homo sapiens (human) hsa-miR-34c-3p
  5. Macaca mulatta mml-miR-34c-3p
  6. Oryctolagus cuniculus (rabbit) ocu-miR-34c-3p
  7. Pan troglodytes ptr-miR-34c
  8. Pongo pygmaeus ppy-miR-34c-3p
  9. Pteropus alecto pal-miR-34c-3p