Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-34c URS00002C7B2B_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-34c: Ssc-mir-34c is a microRNA that has been found to be upregulated in various studies [PMC8367414][PMC7531090][PMC6090871][PMC10000162][PMC9220968][PMC7724732][PMC7247556][PMC5909910]. It is one of the most abundant miRNAs [PMC7724732] and has been implicated in the regulation of male sexual function [PMC7531090]. Ssc-mir-34c has been found to target genes such as phospholipase C beta 1 (PLCĪ²1) and serine/threonine/tyrosine interacting protein (STYX) involved in signaling pathways such as GnRH, Wnt, and MAPK [PMC7531090]. It has also been shown to target genes involved in the p53 signaling pathway, including cyclin D2 (CCND2), phosphatase and tensin homolog (PTEN), and cyclin B1 (CCNB1) [PMC7531090]. Ssc-mir-34c has been implicated in viral pathogenicity as it can bind to the 3' UTR of the CHX1401 virus genome [PMC10000162]. Additionally, it forms a ceRNA relationship with ssc-miR-9851-3p and ssc-miR-34c, regulating the corresponding NR4A2 gene [PMC9220968]. Ssc-mir-34c expression is affected by ischemia/reperfusion, but can be modulated by ischemic preconditioning (IPC) and ischemic postconditioning (IPoC) [ PMC7247556]. Overall, ssc-mir-34c plays a role in various biological processes through its regulation of target genes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGUGUAGUUAGCUGAUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis Ami-Mir-34-P2b_5p (mature (guide))
  2. Bos taurus (cattle) Bta-Mir-34-P2b_5p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-34c
  4. Canis lupus familiaris (dog) cfa-miR-34c
  5. Capra hircus (goat) chi-miR-34c-5p
  6. Cavia porcellus cpo-miR-34c-5p
  7. Chrysemys picta bellii Cpi-Mir-34-P2b_5p (mature (guide))
  8. Chrysemys picta cpi-miR-34c-5p
  9. Columba livia (rock pigeon) cli-miR-34c-5p
  10. Cricetulus griseus (Chinese hamster) cgr-miR-34c-5p
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-34c-5p
  12. Echinops telfairi Ete-Mir-34-P2b_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-34c
  14. Gallus gallus gga-miR-34c-5p
  15. Homo sapiens (human) hsa-miR-34c-5p
  16. Macaca mulatta mml-miR-34c-5p
  17. Microcebus murinus mmr-miR-34c
  18. Monodelphis domestica (gray short-tailed opossum) mdo-miR-34c-5p
  19. Mus musculus (house mouse) mmu-miR-34c-5p
  20. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-34c
  21. Ornithorhynchus anatinus oan-miR-34a-5p
  22. Oryctolagus cuniculus (rabbit) ocu-miR-34c-5p
  23. Otolemur garnettii (small-eared galago) oga-miR-34c
  24. Pan paniscus ppa-miR-34c
  25. Pongo pygmaeus ppy-miR-34c-5p
  26. Pteropus alecto pal-miR-34c-5p
  27. Rattus norvegicus (Norway rat) rno-miR-34c-5p
  28. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P2b_5p (mature (guide))
  29. Scyliorhinus torazame Sto-Mir-34-P2a_5p (mature (guide))
  30. Sphenodon punctatus Spt-Mir-34-P2b_5p (mature (guide))
  31. Taeniopygia guttata tgu-miR-34b
  32. Tupaia chinensis tch-miR-34c-5p
  33. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-1334552
Publications