Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-222-3p URS00002C6949_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (IntAct, GeneCards, MalaCards, TarBase, LncBase, ENA, miRBase, RefSeq). Described in 83 papers. Homo sapiens (human) hsa-miR-222-3p sequence is a product of hsa-miR-222-3p, hsa-miR-222, 222, mir-222, miR-222, MIR222, miR-222-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 182-FIP, 53BP2, 82-FIP, A-myb, A121, A170, ABHD10, ABHD3.

Interactions 4

According to IntAct, Homo sapiens (human) hsa-miR-222-3p interacts with:

IntAct ID Participant Synonyms
EBI-22266609 URS0000CCE0E6_9606 EBI-16420641 HGNC:16355 URS0000CCE0E6_9606 gas5
EBI-22267281 URS0000CCE0E6_9606 EBI-16420641 HGNC:16355 URS0000CCE0E6_9606 gas5
EBI-22267244 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-22267291 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCUACAUCUGGCUACUGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Bos taurus bta-miR-222
    2. Canis lupus familiaris cfa-miR-222
    3. Equus caballus (horse) eca-miR-222
    4. Macaca mulatta mml-miR-222-3p
    5. Mus musculus (house mouse) TARBASE:mmu-miR-222-3p
    6. Ornithorhynchus anatinus (platypus) oan-miR-222a-3p
    7. Pongo pygmaeus ppy-miR-222
    8. Rattus norvegicus rno-miR-222-3p
    9. Sarcophilus harrisii (Tasmanian devil) sha-miR-222
    10. Tupaia chinensis (Chinese tree shrew) tch-miR-222-3p
    11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3161177