Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-222-3p URS00002C6949_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (IntAct, miRBase, ENA, LncBase, RefSeq, MalaCards, GeneCards, TarBase, PSICQUIC). Homo sapiens (human) hsa-miR-222-3p sequence is a product of hsa-miR-222-3p, hsa-miR-222, MIR222, miR-222-3p, miR-222, 222, mir-222 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 182-FIP, 53BP2, 82-FIP, A-myb, A121, A170, ABHD10, ABHD3.

Interactions 71

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-222-3p interacts with:

Interaction id Participant Synonyms
EBI-22266609 URS0000CCE0E6_9606 EBI-16420641 HGNC:16355 URS0000CCE0E6_9606 gas5
EBI-22267281 URS0000CCE0E6_9606 EBI-16420641 HGNC:16355 URS0000CCE0E6_9606 gas5
EBI-22267291 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-22267244 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-27027963 intact:EBI-27027966 EBI-27027966 ENST00000344922 mrna_mia3
URS00002C6949_9606-34 O43524 O43524
URS00002C6949_9606-0 O43524 O43524
URS00002C6949_9606-1 O95980 O95980
URS00002C6949_9606-35 O95980 O95980
URS00002C6949_9606-36 P01100 P01100
URS00002C6949_9606-2 P01100 P01100
URS00002C6949_9606-3 P03956 P03956
URS00002C6949_9606-37 P03956 P03956
URS00002C6949_9606-38 P04179 P04179
URS00002C6949_9606-4 P04179 P04179
URS00002C6949_9606-6 P10721 P10721
URS00002C6949_9606-39 P10721 P10721
URS00002C6949_9606-41 P10721 P10721
URS00002C6949_9606-40 P10721 P10721
URS00002C6949_9606-8 P10721 P10721
URS00002C6949_9606-7 P10721 P10721
URS00002C6949_9606-5 P10721 P10721
URS00002C6949_9606-42 P14921 P14921
URS00002C6949_9606-10 P14921 P14921
URS00002C6949_9606-9 P14921 P14921
URS00002C6949_9606-43 P14921 P14921
URS00002C6949_9606-44 P16144 P16144
URS00002C6949_9606-11 P16144 P16144
URS00002C6949_9606-12 P16455 P16455
URS00002C6949_9606-45 P16455 P16455
URS00002C6949_9606-13 P17302 P17302
URS00002C6949_9606-46 P17302 P17302
URS00002C6949_9606-47 P35625 P35625
URS00002C6949_9606-33 P35625 P35625
URS00002C6949_9606-14 P42229 P42229
URS00002C6949_9606-15 P42229 P42229
URS00002C6949_9606-49 P42229 P42229
URS00002C6949_9606-48 P42229 P42229
URS00002C6949_9606-16 P46527 P46527
URS00002C6949_9606-17 P46527 P46527
URS00002C6949_9606-18 P46527 P46527
URS00002C6949_9606-19 P46527 P46527
URS00002C6949_9606-50 P46527 P46527
URS00002C6949_9606-51 P46527 P46527
URS00002C6949_9606-52 P46527 P46527
URS00002C6949_9606-21 P49918 P49918
URS00002C6949_9606-20 P49918 P49918
URS00002C6949_9606-53 P49918 P49918
URS00002C6949_9606-54 P49918 P49918
URS00002C6949_9606-55 P60484 P60484
URS00002C6949_9606-22 P60484 P60484
URS00002C6949_9606-23 P62820 P62820
URS00002C6949_9606-56 P62820 P62820
URS00002C6949_9606-57 P63151 P63151
URS00002C6949_9606-24 P63151 P63151
URS00002C6949_9606-25 P78536 P78536
URS00002C6949_9606-58 P78536 P78536
URS00002C6949_9606-59 Q14135 Q14135
URS00002C6949_9606-26 Q14135 Q14135
URS00002C6949_9606-60 Q5U5R9 Q5U5R9
URS00002C6949_9606-27 Q5U5R9 Q5U5R9
URS00002C6949_9606-61 Q8NBP7 Q8NBP7
URS00002C6949_9606-28 Q8NBP7 Q8NBP7
URS00002C6949_9606-29 Q9BXH1 Q9BXH1
URS00002C6949_9606-62 Q9BXH1 Q9BXH1
URS00002C6949_9606-63 Q9HBE4 Q9HBE4
URS00002C6949_9606-30 Q9HBE4 Q9HBE4
URS00002C6949_9606-64 Q9UHF7 Q9UHF7
URS00002C6949_9606-31 Q9UHF7 Q9UHF7
URS00002C6949_9606-65 Q9UPY3 Q9UPY3
URS00002C6949_9606-32 Q9UPY3 Q9UPY3

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUACAUCUGGCUACUGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Bos taurus bta-miR-222
    2. Canis lupus familiaris cfa-miR-222
    3. Equus caballus (horse) eca-miR-222
    4. Macaca mulatta (Rhesus monkey) mml-miR-222-3p
    5. Mus musculus (house mouse) TARBASE:mmu-miR-222-3p
    6. Ornithorhynchus anatinus oan-miR-222a-3p
    7. Pongo pygmaeus ppy-miR-222
    8. Rattus norvegicus (Norway rat) rno-miR-222-3p
    9. Sarcophilus harrisii sha-miR-222
    10. Tupaia chinensis (Chinese tree shrew) tch-miR-222-3p
    11. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3161177
    Publications New