Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila ananassae Dan-Mir-1006_pre stem-loop secondary structure diagram

Drosophila ananassae Dan-Mir-1006_pre stem-loop URS00002C4896_7217

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAGUUUGAAAUUGAAAUGCGUAAAUUGUUUGGUACAAUUUAAAUUCGAUUUCUUAUUCAUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Drosophila melanogaster microRNA dme-mir-1006 precursor
  2. Drosophila simulans Dsi-Mir-1006_pre stem-loop
  3. Drosophila yakuba Dya-Mir-1006_pre stem-loop
2D structure