Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548o-5p URS00002C02E4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548c: Hsa-mir-548c is a miRNA that has been associated with longer survival times in patients with STAD (stomach adenocarcinoma) [PMC6448084]. It has been confirmed to downregulate CAMK1D, a protective miRNA [PMC6448084]. On the other hand, hsa-mir-1255a, hsa-mir-3687, and hsa-mir-9-3 have been associated with shorter survival times in STAD patients [PMC6448084]. These miRNAs can be used as risk factors or protective indicators with prognostic ability in STAD patients [PMC6448084]. Patients with high levels of hsa-mir-1255a, hsa-mir-3687, and hsa-mir-9-3 have high risk scores and shorter survival times, while those with high levels of hsa-mir-548c and hsa-mir-7-2 have low risk scores and longer survival times [PMC6448084]. Hsa-mir-548c plays a complex and important role in the development of STAD [PMC6448084]. It is part of a 5-miRNA signature (hsa-mir1255a, hsa-miR3687, hsa-miR9.3, hsa mir548c and has mir 7.2) that can independently predict the survival time of STAD patients [PMC6448084]. Elevated expression levels of HSA mir 1255a, HSA mir 3687, and HSA mir 9.3 are associated with poor prognosis [PMC6448084]. HSA-MIR-548C is also upregulated in esophageal cancer tissues compared to normal esophageal tissues [PMC8325912]. It is part of a microRNA prognostic panel for gastric cancer patients [PMC7692123]. The relationship between hsa-mir-548c and CCNB1 is unknown [PMC9852745]. It has been found to be upregulated or downregulated in various cancers [PMC3794036]. The functional studies in endometrial, ovarian, and liver cancer suggest that decreased hsa-mir-548c expression promotes cell migration and invasion potentially by silencing the EMT marker TWIST [PMC5823652].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGUAAUUGCGGUUUUUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-548o
Publications