Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00002BD8E6_559292

Automated summary: This snoRNA sequence is 183 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (IntAct, ENA, RefSeq, Rfam, SGD). Described in 55 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR33, RF01243). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR33 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

IntAct ID Participant Synonyms
EBI-12512966 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-10921312 P28007 D3DL41 EBI-7321 GAR1 P28007 YHR089C gar1_yeast snoRNP protein GAR1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAGCUUAAUGCCCUCUUUGUACGAUGGUGUCACUCUAAAAUUAUUUACGUAAUUUAAUUGGAUGUGAUAUCAAGCACUAGUUUUGUUUGGAGGAGCAGAGAUUGAAAGCCUAGCUUUUACACCGGUUUGAGUCGGUUCCUUCGUUUUCUUAGUUGGAAUUGAUAUAGAAGUGUGUGGACAAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 78 other species

    1. Saccharomyces cerevisiae AWRI796 Small nucleolar RNA snR33
    2. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR33
    3. Saccharomyces cerevisiae EC1118 SNR33
    4. Saccharomyces cerevisiae FostersB Small nucleolar RNA snR33
    5. Saccharomyces cerevisiae Kyokai no. 7 K7_snR33
    6. Saccharomyces cerevisiae Lalvin QA23 Small nucleolar RNA snR33
    7. Saccharomyces cerevisiae P301 SNR33
    8. Saccharomyces cerevisiae PE-2 SNR33
    9. Saccharomyces cerevisiae R008 SNR33
    10. Saccharomyces cerevisiae R103 SNR33
    11. Saccharomyces cerevisiae Vin13 Small nucleolar RNA snR33
    12. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR33
    13. Saccharomyces cerevisiae YJM1078 SNR33
    14. Saccharomyces cerevisiae YJM1129 SNR33
    15. Saccharomyces cerevisiae YJM1133 SNR33
    16. Saccharomyces cerevisiae YJM1190 SNR33
    17. Saccharomyces cerevisiae YJM1199 SNR33
    18. Saccharomyces cerevisiae YJM1202 SNR33
    19. Saccharomyces cerevisiae YJM1208 SNR33
    20. Saccharomyces cerevisiae YJM1242 SNR33
    21. Saccharomyces cerevisiae YJM1244 SNR33
    22. Saccharomyces cerevisiae YJM1248 SNR33
    23. Saccharomyces cerevisiae YJM1250 SNR33
    24. Saccharomyces cerevisiae YJM1252 SNR33
    25. Saccharomyces cerevisiae YJM1273 SNR33
    26. Saccharomyces cerevisiae YJM1304 SNR33
    27. Saccharomyces cerevisiae YJM1311 SNR33
    28. Saccharomyces cerevisiae YJM1326 SNR33
    29. Saccharomyces cerevisiae YJM1332 SNR33
    30. Saccharomyces cerevisiae YJM1336 SNR33
    31. Saccharomyces cerevisiae YJM1338 SNR33
    32. Saccharomyces cerevisiae YJM1341 SNR33
    33. Saccharomyces cerevisiae YJM1355 SNR33
    34. Saccharomyces cerevisiae YJM1356 SNR33
    35. Saccharomyces cerevisiae YJM1381 SNR33
    36. Saccharomyces cerevisiae YJM1383 SNR33
    37. Saccharomyces cerevisiae YJM1385 SNR33
    38. Saccharomyces cerevisiae YJM1386 SNR33
    39. Saccharomyces cerevisiae YJM1387 SNR33
    40. Saccharomyces cerevisiae YJM1399 SNR33
    41. Saccharomyces cerevisiae YJM1400 SNR33
    42. Saccharomyces cerevisiae YJM1401 SNR33
    43. Saccharomyces cerevisiae YJM1415 SNR33
    44. Saccharomyces cerevisiae YJM1417 SNR33
    45. Saccharomyces cerevisiae YJM1419 SNR33
    46. Saccharomyces cerevisiae YJM1434 SNR33
    47. Saccharomyces cerevisiae YJM1439 SNR33
    48. Saccharomyces cerevisiae YJM1444 SNR33
    49. Saccharomyces cerevisiae YJM1447 SNR33
    50. Saccharomyces cerevisiae YJM1450 SNR33
    51. Saccharomyces cerevisiae YJM1463 SNR33
    52. Saccharomyces cerevisiae YJM1477 SNR33
    53. Saccharomyces cerevisiae YJM1479 SNR33
    54. Saccharomyces cerevisiae YJM1526 SNR33
    55. Saccharomyces cerevisiae YJM1574 SNR33
    56. Saccharomyces cerevisiae YJM189 SNR33
    57. Saccharomyces cerevisiae YJM195 SNR33
    58. Saccharomyces cerevisiae YJM244 SNR33
    59. Saccharomyces cerevisiae YJM248 SNR33
    60. Saccharomyces cerevisiae YJM271 SNR33
    61. Saccharomyces cerevisiae YJM326 SNR33
    62. Saccharomyces cerevisiae YJM428 SNR33
    63. Saccharomyces cerevisiae YJM450 SNR33
    64. Saccharomyces cerevisiae YJM453 SNR33
    65. Saccharomyces cerevisiae YJM627 SNR33
    66. Saccharomyces cerevisiae YJM681 SNR33
    67. Saccharomyces cerevisiae YJM682 SNR33
    68. Saccharomyces cerevisiae YJM683 SNR33
    69. Saccharomyces cerevisiae YJM689 SNR33
    70. Saccharomyces cerevisiae YJM693 SNR33
    71. Saccharomyces cerevisiae YJM969 SNR33
    72. Saccharomyces cerevisiae YJM972 SNR33
    73. Saccharomyces cerevisiae YJM975 SNR33
    74. Saccharomyces cerevisiae YJM978 SNR33
    75. Saccharomyces cerevisiae YJM984 SNR33
    76. Saccharomyces cerevisiae YJM987 SNR33
    77. Saccharomyces cerevisiae YJM990 SNR33
    78. Saccharomyces cerevisiae YJM993 SNR33
    79. Saccharomyces cerevisiae YJM996 SNR33
    2D structure New