Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-424-3p URS00002BCF86_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-424: Bta-mir-424 is a microRNA that has been found to be upregulated in HC samples [PMC4617749]. It is one of eight miRNAs, including bta-miR-99a, bta-miR-10b, bta-miR-199a-3p, bta-miR-199a-5p, bta-mir-424, bta-miR-100, bta-miR-455, and bta-miR-214, that are expressed at a 10-fold greater level in the fetal bovine ovary compared to somatic tissue pools [PMC4522283]. Further analysis has shown that both bta-mir-424 and bta-miR-10b are highly abundant in germinal vesicle (GV) oocytes [PMC4522283]. These miRNAs are also highly expressed in fetal bovine ovaries compared to somatic tissues [PMC9783981]. Specifically, the expression of miRNAs including bta-mir-424 and bta-miR10b is 10 times higher in fetal bovine ovaries than in the pool of somatic tissues [PMC9783981]. In addition to being highly abundant in GV oocytes and fetal bovine ovaries, it has been found that miRNA* (the star form of the microRNA) for both mir126 and mir424 are more abundant than their corresponding microRNAs [PMC3563516]. This expression pattern suggests that mir424 may be maternally inherited and involved in the turnover of maternal transcripts during zygotic gene activation [PMC3164151]. Although not identified using Solexa sequencing and QPCR methods for bovine testis or ovary samples, mir424 expression was found to be highly abundant in GV and MII stage oocytes as well as early stage embryos, with a tendency to decrease in morula and blastocyst stage embryos [PMC3164151].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAACGUGAGGCGCUGCUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Canis lupus familiaris cfa-miR-424
  2. Capra hircus (goat) chi-miR-424-3p
  3. Cervus elaphus (red deer) cel-miR-424*
  4. Homo sapiens (human) hsa-miR-424-3p
  5. Pteropus alecto (black flying fox) pal-miR-424-3p
  6. Sus scrofa (pig) ssc-miR-424-3p
Publications