Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-92a precursor (bta-mir-92a-1) secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-92a precursor (bta-mir-92a-1) URS00002B6637_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-92a: Bta-mir-92a is a microRNA that has been identified as a potential diagnostic tool for animals exposed to pathogens [PMC4990326]. In a study comparing positive and negative groups, it was found that the negative group had a higher number of counts for bta-mir-92a [PMC4990326]. High expression levels of bta-mir-92a have also been detected in skeletal muscle [PMC4410957]. Bta-mir-92a is one of the top 10 highly expressed miRNAs in various samples, indicating its abundance and potential importance [PMC4156418]. Furthermore, bta-mir-92a is one of the immune-related miRNAs that are highly expressed in cattle [PMC6940744]. In different studies, bta-mir-92a has been found to be misregulated in liver and tongue tissues [PMC6691986]. It has also been shown to be downregulated in extracellular vesicles secreted by arrested embryos but upregulated in competent embryos [PMC7727673]. Bta-mir-92a is co-detected with other miRNAs in 8-cell and blastocyst samples, suggesting its involvement in early embryonic development [PMC8060439]. Additionally, it is one of the immune-related miRNAs highly expressed in bovine samples [PMC7070426]. Bta-mir-92a has also been reported as highly expressed in blood exosomes of dairy cows [PMC9445238]. Overall, bta-mir-92a shows potential as a diagnostic tool and plays a role in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Ailuropoda melanoleuca mir-92 microRNA precursor family
  2. Aotus nancymaae miRNA (ENSANAG00000004922.1)
  3. Ateles geoffroyi microRNA age-mir-92 precursor (age-mir-92-1)
  4. Callithrix jacchus mir-92 microRNA precursor family
  5. Camelus ferus mir-92 microRNA precursor family
  6. Canis lupus familiaris mir-92 microRNA precursor family
  7. Carlito syrichta miRNA (ENSTSYG00000021444.2)
  8. Cavia porcellus microRNA 92a-1 (ENSCPOG00000016799.3)
  9. Cebus imitator (Panamanian white-faced capuchin) microRNA 92a-1 (ENSCCAG00000016785.1)
  10. Cercocebus atys miRNA (ENSCATG00000011899.1)
  11. Chinchilla lanigera microRNA 92a-1 (ENSCLAG00000021281.1)
  12. Chlorocebus sabaeus mir-92 microRNA precursor family
  13. Colobus angolensis palliatus miRNA (ENSCANG00000001649.1)
  14. Equus caballus mir-92 microRNA precursor family
  15. Felis catus (domestic cat) mir-92 microRNA precursor family
  16. Gorilla gorilla gorilla ggo-mir-92-1 (ENSGGOG00000033055.2)
  17. Gorilla gorilla (western gorilla) microRNA ggo-mir-92 precursor (ggo-mir-92-1)
  18. Heterocephalus glaber mir-92 microRNA precursor family
  19. Homo sapiens (human) microRNA hsa-mir-92a precursor (hsa-mir-92a-1)
  20. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 92a-1 (ENSSTOG00000016693.3)
  21. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-92 precursor (lla-mir-92-1)
  22. Lemur catta (Ring-tailed lemur) microRNA lca-mir-92 precursor (lca-mir-92-1)
  23. Macaca mulatta (Rhesus monkey) microRNA mml-mir-92a precursor (mml-mir-92a-1)
  24. Macaca nemestrina miRNA (ENSMNEG00000005615.1)
  25. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000018759.1)
  26. Marmota monax non-coding RNA
  27. Microcebus murinus microRNA 92a-1 (ENSMICG00000018733.3)
  28. Otolemur garnettii mir-92 microRNA precursor family
  29. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-92a precursor (ppa-mir-92a-1)
  30. Panthera pardus (leopard) microRNA 92a-1 (ENSPPRG00000013776.1)
  31. Panthera tigris altaica (Tiger) microRNA 92a-1 (ENSPTIG00000002967.1)
  32. Pan troglodytes microRNA ptr-mir-92 precursor (ptr-mir-92-1)
  33. Papio anubis (Olive baboon) mir-92 microRNA precursor family
  34. Pongo pygmaeus mir-92 microRNA precursor family
  35. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000008762.1)
  36. Pteropus alecto (black flying fox) mir-92 microRNA precursor family
  37. Pteropus vampyrus (large flying fox) microRNA 92a-1 (ENSPVAG00000025207.1)
  38. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000013317.1)
  39. Rhinopithecus roxellana microRNA 92a-1 (ENSRROG00000007886.1)
  40. Saguinus labiatus microRNA sla-mir-92 precursor (sla-mir-92-1)
  41. Saimiri boliviensis boliviensis microRNA 92a-1 (ENSSBOG00000018855.1)
  42. Sus scrofa (pig) mir-92 microRNA precursor family
  43. Tursiops truncatus (bottlenosed dolphin) microRNA 92a-1 (ENSTTRG00000021803.1)
  44. Vicugna pacos microRNA 92a-1 (ENSVPAG00000015675.1)
2D structure Publications