v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-1251 URS00002B4E74_9913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUCUAGCUGCCAAAGGCGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1251
  2. Canis lupus familiaris (dog) Cfa-Mir-1251_5p (mature (guide))
  3. Cavia porcellus (domestic guinea pig) cpo-miR-1251-5p
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-1251-5p
  5. Echinops telfairi Ete-Mir-1251_5p (mature (guide))
  6. Homo sapiens (human) hsa-miR-1251-5p
  7. Macaca mulatta (Rhesus monkey) mml-miR-1251-5p
  8. Mus musculus (house mouse) mmu-miR-1251-5p
  9. Oryctolagus cuniculus (rabbit) ocu-miR-1251-5p
  10. Pan troglodytes ptr-miR-1251
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-1251
  12. Rattus norvegicus (Norway rat) Rno-Mir-1251_5p (mature (guide))
 Publications