Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-200b URS00002B452B_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-200b: Ssc-mir-200b is a functional miRNA that has been identified in various studies [PMC9603960] [PMC8122421] [PMC7685987] [PMC9961432]. It has been shown to target the porcine spermatogenesis-associated serine-rich 2-like (SPATS2L) gene, which significantly affects litter size [PMC7685987] [PMC9961432]. Ssc-mir-200b is one of the most abundant miRNAs found in boar seminal plasma extracellular vesicles (SP-EVs) [PMC7685987]. It is also among the top 10 most abundant miRNAs in boar SP-EVs, comprising a significant proportion of total miRNA reads [PMC7685987]. Ssc-mir-200b, along with other miRNAs such as ssc-miR-10b and ssc-miR-10a-5p, is found in both groups of differentially expressed miRNAs and among the topmost abundant miRNAs in sperm datasets, suggesting its critical regulatory role in various physiological processes in sperm [PMC9961432]. Overall, ssc-mir-200b has been identified as an important functional miRNA that may play a role in spermatogenesis and influence litter size.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGCCUGGUAAUGAUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications