Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-369-5p URS00002A71AD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-369: Hsa-mir-369 is a hub DE miRNA that has been identified through the interaction of DE lncRNAs-miRNAs, miRNAs-DE mRNAs, and DE miRNAs [PMC8176956]. It is part of a miRNA cluster in the human Dlk1/Gtl2 domain at chromosome 14q32, along with hsa-miR-127 [PMC3404966]. While hsa-mir-369's involvement in cancer is not yet documented, it has been found to play a role in translational efficiency on cell cycle exit under growth arrest conditions [PMC3404966]. Hsa-mir-369 has been identified as a potential target for FOXO1, along with hsa-mir-135b and hsa-mir-324 [PMC5356276]. In the context of medical information from patients, hsa-mir-369 has been predicted as one of the five miRNAs that could be considered as molecular targets for prognosis prediction [PMC4627364]. A mathematical model for miRNA and survival time was constructed using Cox multivariate regression model, and hsa-mir-369 was included in the prognosis formula along with other selected miRNAs [PMC4627364]. Additionally, PLCG1 has been identified as a potential target of hsa-mir-369 among other miRNAs [PMC7146847]. Overall, while there is limited documentation on its involvement in cancer, hsa-mir-369 shows potential as a molecular target for prognosis prediction and may play a role in translational efficiency under growth arrest conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUCGACCGUGUUAUAUUCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Cricetulus griseus cgr-miR-369-5p
  2. Macaca mulatta mml-miR-369-5p
  3. Mus musculus (house mouse) mmu-miR-369-5p
  4. Pongo pygmaeus ppy-miR-369-5p
  5. Rattus norvegicus (Norway rat) rno-miR-369-5p
Publications