Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila ananassae dan-miR-285 URS00002A5B75_7217

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUCGAAAUCAGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-285-3p
  2. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-285-3p
  3. Drosophila erecta der-miR-285
  4. Drosophila grimshawi dgr-miR-285
  5. Drosophila melanogaster (fruit fly) dme-miR-285-3p
  6. Drosophila mojavensis dmo-miR-285
  7. Drosophila pseudoobscura dps-miR-285
  8. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294501_df_nrg
  9. Drosophila sechellia dse-miR-285
  10. Drosophila simulans dsi-miR-285
  11. Drosophila virilis dvi-miR-285-3p
  12. Drosophila willistoni dwi-miR-285
  13. Drosophila yakuba dya-miR-285