Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-194 URS000029C2DC_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-194: Gga-mir-194 is a differentially expressed miRNA that has been identified in several studies [PMC7797159] [PMC8633681] [PMC5468434] [PMC5495669] [PMC7555432] [PMC5203650]. It has been found to be involved in muscle cell differentiation and is part of ceRNA networks containing various lncRNAs, such as LNC_000668, LNC_000569, LNC_001009, ALDBGALT0000000938, LNC_001086, LNC_000373, LNC_000920, and LNC_001140 [PMC7797159]. The expression trend of gga-mir-194 has been validated using qPCR in high throughput sequencing data and it was found to be differentially expressed along with other miRNAs such as gga-mir-146a, gga-miR-215, gga-miR-135b, gga-miR-205b and gga-miR-214 [PMC8633681]. Target genes of gga-mir-194 have been predicted using miRDB and TargetScan programs along with other differentially expressed miRNAs such as gga-miR-122-5p and gga-miR-375 among others [PMC5468434]. The expression levels of gga-mir-194 have shown significant changes in various experimental groups compared to control groups in different studies. For example, it exhibited significant changes in the CS versus CM group but very little difference in the CM versus NC group. Similarly, it showed big changes in the CM but small changes in the CS group compared to control groups. These findings suggest that the expression of gga-mir-194 is influenced by specific experimental conditions or treatments [PMC5203650].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAACAGCAACUCCAUGUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Anolis carolinensis aca-miR-194-5p
  2. Ateles geoffroyi age-miR-194
  3. Bos taurus bta-miR-194
  4. Callithrix jacchus cja-miR-194
  5. Callorhinchus milii (elephant shark) Cmi-Mir-194-P1_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-194
  7. Capra hircus (goat) chi-miR-194
  8. Cervus elaphus cel-miR-194
  9. Chrysemys picta cpi-miR-194-5p
  10. Cricetulus griseus cgr-miR-194
  11. Cyprinus carpio ccr-miR-194
  12. Eptatretus burgeri Ebu-Mir-194-o1_5p (mature (guide))
  13. Eptesicus fuscus efu-miR-194
  14. Equus caballus eca-miR-194
  15. Gadus morhua gmo-miR-194a-5p
  16. Gorilla gorilla gorilla ggo-miR-194 (MIR194)
  17. Gorilla gorilla ggo-miR-194
  18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-194a
  19. Homo sapiens (human) hsa-miR-194-5p
  20. Ictalurus punctatus (channel catfish) ipu-miR-194a
  21. Macaca mulatta (Rhesus monkey) mml-miR-194-5p
  22. Macaca nemestrina (pig-tailed macaque) mne-miR-194
  23. Maylandia zebra mze-miR-194a
  24. Mus musculus mmu-miR-194-5p
  25. Neolamprologus brichardi (lyretail cichlid) nbr-miR-194a
  26. Ophiophagus hannah (king cobra) oha-miR-194-5p
  27. Oreochromis niloticus (Nile tilapia) oni-miR-194a
  28. Ornithorhynchus anatinus (platypus) oan-miR-194-5p
  29. Ovis aries (sheep) oar-miR-194
  30. Pan troglodytes ptr-miR-194
  31. Petromyzon marinus Pma-Mir-194-o1_5p (mature (guide))
  32. Pongo pygmaeus (Bornean orangutan) ppy-miR-194
  33. Pundamilia nyererei pny-miR-194a
  34. Python bivittatus pbv-miR-194-5p
  35. Rattus norvegicus rno-miR-194-5p
  36. Salmo salar (Atlantic salmon) ssa-miR-194a-5p
  37. Taeniopygia guttata tgu-miR-194-5p
  38. Xenopus laevis xla-miR-194
  39. Xenopus tropicalis xtr-miR-194
Publications