Homo sapiens (human) hsa-miR-3651

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3651 URS0000299AD8_9606

24 nucleotides
7 databases (ENA, GeneCards, LncBase, MalaCards, miRBase, RefSeq, TarBase)
Found in 0 other species
124 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3651: Hsa-mir-3651 is a microRNA that has been identified as the most differentially expressed miRNA in a microarray analysis (N = 23, fold change 4.37; raw p value = 0.0035) [PMC8885475]. Additionally, it has been found to be up-regulated in cancer patients [PMC8885475].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CAUAGCCCGGUCGCUGGUACAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications