Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1226-3p URS00002971AB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1226: hsa-mir-1226 is a conventional mirtron, predicted to have 1109 matches [PMC6411762]. In a study, members of all three mirtron biogenesis classes were selected for functional study, including hsa-mir-1226 [PMC3431481]. hsa-mir-5010 is a 5'-tailed mirtron and mmu-mir-668 is a 3'-tailed mirtron [PMC3431481]. The sequences and probes for hsa-mir-5010, mmu-mir-668, and hsa-mir-1226 were provided [PMC3431481]. Interestingly, there is similarity between the bean common mosaic virus cowpea isolate Y and hsa-miR-1226 in the parallel direction, with 14 shared nucleotides including the miR's seed region [PMC3821693]. In humans, there are 312 conserved targets for hsa-mir-1226 including NRP1 and NPAS3 which are involved in cell migration control and neurogenesis respectively [PMC3821693]. The pre-miRNA of hsa-mir-1226 is an intron in the putative RNA helicase DHX30 gene and it is processed by the splicing machinery without Drosha cleavage [PMC6004052]. References: [PMC6411762] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6411762/ [PMC3431481] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3431481/ [PMC3821693] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3821693/ [PMC6004052] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6004052/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCACCAGCCCUGUGUUCCCUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Macaca mulatta (Rhesus monkey) mml-miR-1226
  2. Pan troglodytes ptr-miR-1226
  3. Pongo pygmaeus (Bornean orangutan) ppy-miR-1226
Publications