v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Clunio marinus tRNA secondary structure diagram

Clunio marinus tRNA URS000028FEB0_568069

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACUCCGUGGCGCAACGGUAGCGCGUCCGACUCCAGAUCGGAAGGUUGCGUGUUCAAAUCACGUCGGGGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Ciona intestinalis tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  2. Ciona savignyi tRNA
  3. Drosophila ananassae tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 5)
  4. Drosophila erecta tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 6)
  5. Drosophila ficusphila tRNA
  6. Drosophila gunungcola tRNA-OTHER
  7. Drosophila melanogaster transfer RNA:Tryptophan-CCA 2-3 (multiple genes)
  8. Drosophila sechellia tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 6)
  9. Drosophila simulans tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 6)
  10. Drosophila yakuba tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 6)
 2D structure Publications