Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans cel-miR-54-3p URS000028E50A_6239

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cel-mir-54: Cel-mir-54 is a specific miRNA target that was addressed in a study that aimed to overcome the problem of non-specific hybridizations associated with isomiRs. The study incorporated PG tracts with G4-forming ability into the design of molecular probes for miRNA targets. This approach allowed for more stringent discrimination of cel-mir-54 from mismatched isomiRs [PMC5690596]. To enable relative comparison across the analyzed samples, spike-in normalization was performed using a synthetic C. elegans derived cel-mir-54 sequence [PMC6197019]. The use of spike-in normalization with synthetic cel-mir-54 allowed for accurate comparison and quantification of cel-mir-54 expression levels across different samples. This normalization method helps to account for any variations in sample preparation and sequencing efficiency, ensuring reliable and accurate results [PMC6197019]. By incorporating PG tracts with G4-forming ability into molecular probes and using spike-in normalization, the study successfully addressed the challenges associated with non-specific hybridizations and achieved more stringent discrimination of cel-mir-54 from mismatched isomiRs, providing a valuable approach for studying miRNA targets [PMC5690596][PMC6197019].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCGUAAUCUUCAUAAUCCGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Caenorhabditis brenneri cbn-miR-54
Publications