Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila guanche tRNA.Glu secondary structure diagram

Drosophila guanche tRNA.Glu URS0000289310_7266

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCAUAUUGUCUAGUGGUUAGGAUAUCCGGCUCUCACCCGGAAGGCCCGGGUUCAAUUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Drosophila ananassae tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 6)
  2. Drosophila busckii tRNA
  3. Drosophila erecta tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 8)
  4. Drosophila ficusphila tRNA
  5. Drosophila grimshawi tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 6)
  6. Drosophila gunungcola tRNA-OTHER
  7. Drosophila melanogaster transfer RNA:Glutamic acid-CTC 3-9 (Dmel_CR32322-32330)
  8. Drosophila mojavensis tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 6)
  9. Drosophila persimilis tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1, tRNA-Glu-CTC-2-2)
  10. Drosophila pseudoobscura pseudoobscura tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1)
  11. Drosophila sechellia tRNA-Glu (CTC) (tRNA-Glu-CTC-4 1 to 8)
  12. Drosophila simulans tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 7)
  13. Drosophila virilis tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 5)
  14. Drosophila willistoni tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 4)
  15. Drosophila yakuba tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 8)
2D structure