Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Malus domestica (apple) mdm-miR399a URS000028246C_3750

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCAAAGGAGAAUUGCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Aegilops tauschii ata-miR399a-3p
  2. Ananas comosus (pineapple) microRNA 399j
  3. Brachypodium distachyon (stiff brome) bdi-miR399c
  4. Citrus sinensis (sweet orange) csi-miR399c-3p
  5. Glycine max gma-miR399i
  6. Linum usitatissimum lus-miR399b
  7. Manihot esculenta mes-miR399a
  8. Oryza sativa (Asian cultivated rice) osa-miR399b
  9. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR399b
  10. Populus tomentosa Pto-miR399f
  11. Populus trichocarpa (black cottonwood) ptc-miR399f
  12. Sorghum bicolor sbi-miR399h
  13. Theobroma cacao tcc-miR399g
  14. Vigna unguiculata (cowpea) vun-miR399b
  15. Vitis vinifera vvi-miR399h
  16. Zea mays (maize) zma-miR399h-3p
Publications