Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM270 tRNA-Phe secondary structure diagram

Saccharomyces cerevisiae YJM270 tRNA-Phe URS000027DFD8_1294308

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGACUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAGUUCGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 132 other species

  1. Blastobotrys adeninivorans tRNA Phe (GAA) score
  2. Saccharomyces arboricola H-6 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  3. Saccharomyces boulardii (nom. inval.) tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  4. Saccharomyces cerevisiae AWRI796 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  5. Saccharomyces cerevisiae tRNA-Phe
  6. Saccharomyces cerevisiae CBS 7960 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  7. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  8. Saccharomyces cerevisiae CLIB215 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  9. Saccharomyces cerevisiae CLIB324 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  10. Saccharomyces cerevisiae CLIB382 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  11. Saccharomyces cerevisiae EC1118 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1)
  12. Saccharomyces cerevisiae EC9-8 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  13. Saccharomyces cerevisiae FL100 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1)
  14. Saccharomyces cerevisiae FostersB tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  15. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  16. Saccharomyces cerevisiae Lalvin QA23 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1)
  17. Saccharomyces cerevisiae P283 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1)
  18. Saccharomyces cerevisiae P301 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  19. Saccharomyces cerevisiae PE-2 tRNA-Phe
  20. Saccharomyces cerevisiae PW5 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  21. Saccharomyces cerevisiae R008 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  22. Saccharomyces cerevisiae R103 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  23. Saccharomyces cerevisiae RM11-1a tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  24. Saccharomyces cerevisiae S288C tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  25. Saccharomyces cerevisiae Sigma1278b tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  26. Saccharomyces cerevisiae T73 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1)
  27. Saccharomyces cerevisiae T7 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  28. Saccharomyces cerevisiae UC5 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1)
  29. Saccharomyces cerevisiae UFMG A-905 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  30. Saccharomyces cerevisiae Vin13 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  31. Saccharomyces cerevisiae VL3 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  32. Saccharomyces cerevisiae W303 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  33. Saccharomyces cerevisiae Y10 tRNA-Phe (GAA) (tRNA-Phe-GAA-4-1)
  34. Saccharomyces cerevisiae YJM1078 tRNA-Phe
  35. Saccharomyces cerevisiae YJM1083 tRNA-Phe
  36. Saccharomyces cerevisiae YJM1129 tRNA-Phe
  37. Saccharomyces cerevisiae YJM1133 tRNA-Phe
  38. Saccharomyces cerevisiae YJM1190 tRNA-Phe
  39. Saccharomyces cerevisiae YJM1199 tRNA-Phe
  40. Saccharomyces cerevisiae YJM1202 tRNA-Phe
  41. Saccharomyces cerevisiae YJM1208 tRNA-Phe
  42. Saccharomyces cerevisiae YJM1242 tRNA-Phe
  43. Saccharomyces cerevisiae YJM1244 tRNA-Phe
  44. Saccharomyces cerevisiae YJM1248 tRNA-Phe
  45. Saccharomyces cerevisiae YJM1250 tRNA-Phe
  46. Saccharomyces cerevisiae YJM1252 tRNA-Phe
  47. Saccharomyces cerevisiae YJM1273 tRNA-Phe
  48. Saccharomyces cerevisiae YJM1304 tRNA-Phe
  49. Saccharomyces cerevisiae YJM1307 tRNA-Phe
  50. Saccharomyces cerevisiae YJM1311 tRNA-Phe
  51. Saccharomyces cerevisiae YJM1326 tRNA-Phe
  52. Saccharomyces cerevisiae YJM1332 tRNA-Phe
  53. Saccharomyces cerevisiae YJM1336 tRNA-Phe
  54. Saccharomyces cerevisiae YJM1338 tRNA-Phe
  55. Saccharomyces cerevisiae YJM1341 tRNA-Phe
  56. Saccharomyces cerevisiae YJM1342 tRNA-Phe
  57. Saccharomyces cerevisiae YJM1355 tRNA-Phe
  58. Saccharomyces cerevisiae YJM1356 tRNA-Phe
  59. Saccharomyces cerevisiae YJM1381 tRNA-Phe
  60. Saccharomyces cerevisiae YJM1383 tRNA-Phe
  61. Saccharomyces cerevisiae YJM1385 tRNA-Phe
  62. Saccharomyces cerevisiae YJM1386 tRNA-Phe
  63. Saccharomyces cerevisiae YJM1387 tRNA-Phe
  64. Saccharomyces cerevisiae YJM1388 tRNA-Phe
  65. Saccharomyces cerevisiae YJM1389 tRNA-Phe
  66. Saccharomyces cerevisiae YJM1399 tRNA-Phe
  67. Saccharomyces cerevisiae YJM1400 tRNA-Phe
  68. Saccharomyces cerevisiae YJM1401 tRNA-Phe
  69. Saccharomyces cerevisiae YJM1402 tRNA-Phe
  70. Saccharomyces cerevisiae YJM1415 tRNA-Phe
  71. Saccharomyces cerevisiae YJM1417 tRNA-Phe
  72. Saccharomyces cerevisiae YJM1418 tRNA-Phe
  73. Saccharomyces cerevisiae YJM1419 tRNA-Phe
  74. Saccharomyces cerevisiae YJM1433 tRNA-Phe
  75. Saccharomyces cerevisiae YJM1434 tRNA-Phe
  76. Saccharomyces cerevisiae YJM1439 tRNA-Phe
  77. Saccharomyces cerevisiae YJM1443 tRNA-Phe
  78. Saccharomyces cerevisiae YJM1444 tRNA-Phe
  79. Saccharomyces cerevisiae YJM1447 tRNA-Phe
  80. Saccharomyces cerevisiae YJM1450 tRNA-Phe
  81. Saccharomyces cerevisiae YJM1460 tRNA-Phe
  82. Saccharomyces cerevisiae YJM1463 tRNA-Phe
  83. Saccharomyces cerevisiae YJM1477 tRNA-Phe
  84. Saccharomyces cerevisiae YJM1478 tRNA-Phe
  85. Saccharomyces cerevisiae YJM1479 tRNA-Phe
  86. Saccharomyces cerevisiae YJM1526 tRNA-Phe
  87. Saccharomyces cerevisiae YJM1527 tRNA-Phe
  88. Saccharomyces cerevisiae YJM1549 tRNA-Phe
  89. Saccharomyces cerevisiae YJM1573 tRNA-Phe
  90. Saccharomyces cerevisiae YJM1574 tRNA-Phe
  91. Saccharomyces cerevisiae YJM1592 tRNA-Phe
  92. Saccharomyces cerevisiae YJM1615 tRNA-Phe
  93. Saccharomyces cerevisiae YJM189 tRNA-Phe
  94. Saccharomyces cerevisiae YJM193 tRNA-Phe
  95. Saccharomyces cerevisiae YJM195 tRNA-Phe
  96. Saccharomyces cerevisiae YJM244 tRNA-Phe
  97. Saccharomyces cerevisiae YJM248 tRNA-Phe
  98. Saccharomyces cerevisiae YJM269 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  99. Saccharomyces cerevisiae YJM271 tRNA-Phe
  100. Saccharomyces cerevisiae YJM320 tRNA-Phe
  101. Saccharomyces cerevisiae YJM326 tRNA-Phe
  102. Saccharomyces cerevisiae YJM428 tRNA-Phe
  103. Saccharomyces cerevisiae YJM450 tRNA-Phe
  104. Saccharomyces cerevisiae YJM451 tRNA-Phe
  105. Saccharomyces cerevisiae YJM453 tRNA-Phe
  106. Saccharomyces cerevisiae YJM456 tRNA-Phe
  107. Saccharomyces cerevisiae YJM470 tRNA-Phe
  108. Saccharomyces cerevisiae YJM541 tRNA-Phe
  109. Saccharomyces cerevisiae YJM554 tRNA-Phe
  110. Saccharomyces cerevisiae YJM555 tRNA-Phe
  111. Saccharomyces cerevisiae YJM627 tRNA-Phe
  112. Saccharomyces cerevisiae YJM681 tRNA-Phe
  113. Saccharomyces cerevisiae YJM682 tRNA-Phe
  114. Saccharomyces cerevisiae YJM683 tRNA-Phe
  115. Saccharomyces cerevisiae YJM689 tRNA-Phe
  116. Saccharomyces cerevisiae YJM693 tRNA-Phe
  117. Saccharomyces cerevisiae YJM969 tRNA-Phe
  118. Saccharomyces cerevisiae YJM972 tRNA-Phe
  119. Saccharomyces cerevisiae YJM975 tRNA-Phe
  120. Saccharomyces cerevisiae YJM978 tRNA-Phe
  121. Saccharomyces cerevisiae YJM981 tRNA-Phe
  122. Saccharomyces cerevisiae YJM984 tRNA-Phe
  123. Saccharomyces cerevisiae YJM987 tRNA-Phe
  124. Saccharomyces cerevisiae YJM990 tRNA-Phe
  125. Saccharomyces cerevisiae YJM993 tRNA-Phe
  126. Saccharomyces cerevisiae YJM996 tRNA-Phe
  127. Saccharomyces cerevisiae YJSH1 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  128. Saccharomyces kudriavzevii IFO 1802 tRNA-Phe (GAA) (tRNA-Phe-GAA-2-1, tRNA-Phe-GAA-2-2)
  129. Saccharomyces kudriavzevii ZP591 tRNA-Phe
  130. Saccharomyces mikatae IFO 1815 tRNA-Phe
  131. Saccharomyces uvarum tRNA-Phe
  132. Vector YCy2508 tRNA-Phe
2D structure