Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-2110 URS0000279B6F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-2110: Hsa-mir-2110 is a specific microRNA (miRNA) that has been identified in various studies. It has been detected in PCR experiments using miRCURY LNA PCR primer sets [PMC4546486]. Hsa-mir-2110 has been found to have negative correlations with the lipid TG (17:0/17:0/17:0) and several other miRNAs [PMC8698767]. It has also been identified as one of the downregulated miRNAs in different studies [PMC7489646]. Hsa-mir-2110 is considered a potentially crucial target for alleviating osteoporosis [PMC8647230]. It has been speculated that the target gene of hsa-mir-2110 is TNF (tumor necrosis factor) [PMC8647230]. Another study predicted that hsa-mir-2110 targets TNF and identified it as one of the miRNAs related to specific signaling pathways [PMC8647230]. Hsa-mir-2110 has also been found to inhibit the G3BP1 gene, while another miRNA, hsa-miR-23b-3p, inhibits only the G3BP1 gene [PMC8381622]. Additionally, hsa-mir-2110 has been identified as a potential candidate for improved recombinant protein expression [PMC8304725]. It has also been associated with Epstein-Barr virus-induced oropharyngeal cancer and labeled as downregulated in EV groups [PMC4449560] [PMC7821514]. In studies related to tuberculosis (TB), hsa-mir-2110 was found to be differentially expressed among patients with active TB and latent TB infection (LTBI) compared to healthy individuals or controls. It was specifically expressed in patients with active TB infection but not in those with LTBI or healthy individuals [PMC6930807] [PMC6546874] [PMC6851157]. Hsa-mir-2110 has also been associated with osteogenic induction and osteoporotic effects in human umbilical cord MSC-derived exosomes [PMC9859449]. The sequence of hsa-mir-2110 mimics has been reported in one study [PMC8213778]. In the context of autism spectrum disorder (ASD), hsa-mir-2110 has been found to be one of the most represented miRNAs in ASD patients [PMC9000903]. Overall, hsa-mir-2110 is a specific miRNA that has been identified in various studies and is associated with different diseases and conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGGGAAACGGCCGCUGAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications