Pan paniscus (bonobo) small nucleolar RNA, C/D box 83B (ENSPPAG00000022716.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) small nucleolar RNA, C/D box 83B (ENSPPAG00000022716.1) URS000027315D_9597

93 nucleotides
1 database (Ensembl)
Found in 8 other species
24 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCUGUUCAGUGAUGAGGCCUGGAAUGUGCGCUGGGCACAGCGCCCGAGACAGACUGCGGAACCGUUCCUUGUUGCCUUCCUUCUGAGAACAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Cercocebus atys (Sooty mangabey) small nucleolar RNA, C/D box 83B (ENSCATG00000015589.1)
Colobus angolensis palliatus snoRNA (ENSCANG00000015049.1)
Homo sapiens small nucleolar RNA, C/D box 83B (SNORD83B)
Pan troglodytes small nucleolar RNA, C/D box 83B (ENSPTRG00000033345.2)
Papio anubis (Olive baboon) Small nucleolar RNA U83B
Piliocolobus tephrosceles small nucleolar RNA, C/D box 83B (ENSPTEG00000034359.1)
Pongo abelii small nucleolar RNA, C/D box 83B (ENSPPYG00000024483.2)
Theropithecus gelada (gelada) small nucleolar RNA U83B (ENSTGEG00000010220.1)

2D structure

Publications