Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) mmr-miR-590 URS0000272039_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUUUUAUGUAUAAGCUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Canis lupus familiaris (dog) cfa-miR-590
  2. Cervus elaphus (red deer) cel-miR-590
  3. Equus caballus eca-miR-590-3p
  4. Homo sapiens hsa-miR-590-3p
  5. Mus musculus (house mouse) mmu-miR-590-3p
  6. Pan troglodytes ptr-miR-590
  7. Pongo pygmaeus (Bornean orangutan) ppy-miR-590-3p
  8. Sus scrofa ssc-mir2