v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chlorocebus sabaeus Small nucleolar RNA SNORD75 secondary structure diagram

Chlorocebus sabaeus Small nucleolar RNA SNORD75 URS000026D828_60711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCCUGUGAUGCUUUAAGAGUAGUGGACAGAAGGGAUUUCUGAAAUUCUAUUCUGAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Homo sapiens small nucleolar RNA, C/D box 75 (SNORD75)
  2. Macaca fascicularis (Crab-eating macaque) snoRNA (ENSMFAG00000048687.1)
  3. Macaca mulatta (Macaque) snoRNA (ENSMMUG00000052808.1)
  4. Nomascus leucogenys snoRNA (ENSNLEG00000021520.2)
  5. Pongo abelii snoRNA (ENSPPYG00000024051.2)
 2D structure Publications