v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small Cajal body-specific RNA 13 (SCARNA13) secondary structure diagram

Homo sapiens (human) small Cajal body-specific RNA 13 (SCARNA13) URS000026BDF0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA13: Several of the SS transcripts included well-known somatic nuclear RNAs such as Small Nucleolar RNAs, H/ACA Box (Snora23, Snora52, Snora81), Small Cajal Body-Specific RNA 13 (SCARNA13) and the long non-coding RNA (lncRNA) metastasis associated lung adenocarcinoma transcript 1 (Malat1; Figure 5C) [PMC4538811]. Repaired clones showed a restoration of SCARNA13 3′ end processing (Figure 3H), and SCARNA13 and TERC levels (Figure 3H, Supplementary Figure S3G) [PMC9458449].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUCUGUAGUCUUGGAGCCGCACAGGGUUGGUGGUACCCUCGAGCACACCAGACUUGCAGAAAAAGCAUACUCCAGAGGAAGCUGAGGCAUGCCUGCUCGAGAGCCAGCUGUUCCAUGUGCAAUUUUCCUCUGAUAGUUUCUGGUCACUGUUGCCACGGUGAUAAUGACUGGGCUAUGUCAUUAUCUAUCCGCCAACAGUAAGAGAAGCUUUGCAGUCGAGAUAUUGUUUAGCAGAUGGAGUGUUUUCUGUUGAACACUAAGUACUGCCACAAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications