Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4785 URS0000266339_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4785: Hsa-mir-4785 is a microRNA that has been studied in various contexts. In the presence of LPS, MlEVs were found to partially restore miRNA expression, including the downregulation of hsa-mir-4785 [PMC9898544]. Hsa-mir-4785 is also one of the dysregulated miRNAs common to all four pairwise comparisons in a study [PMC7880712]. It has been observed to be downregulated in human nasal epithelial cells treated with the TLR3 ligand poly(I:C) [PMC5223123]. Hsa-mir-4785 has also been identified as one of the candidates with an ovarian-predominant expression profile in a QPCR analysis [PMC5223123]. Additionally, hsa-mir-4785 is one of the miRNAs that had never been reported as ovarian-predominant in any vertebrate species [PMC5223123]. The ovarian-predominant expression is particularly strict for hsa-mir-4785, along with mmu-miR-6352, dre-miR-729, and hsa-miR-4653 [PMC5223123]. Overall, hsa-mir-4785 has been found to be dysregulated and downregulated in various contexts and may play a role in ovarian function.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAGUCGGCGACGCCGCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications