Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR169o-5p URS0000264C0D_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-miR169o-5p: Zma-mir169o-5p is a miRNA that negatively regulates eight genes, including GRMZM2G165488, GRMZM2G134396, GRMZM2G133568, GRMZM2G098594, GRMZM2G105335, GRMZM2G033230, GRMZM2G399072, and GRMZM2G009871 [PMC9604548]. In addition to zma-mir169o-5p, there are five other miRNAs that target these genes: zma-miR390a-5p, zma-miR396c, zma-miR397b-p5, zma-miR444a and novel-miR4 [PMC9604548]. The expression of these miRNAs is negatively related to the expression of their target genes [PMC9604548]. Zma-mir169o-5p is specifically related to seed storability germination and is down-regulated with the decrease of seed vigor [PMC9604548]. The target gene for zma-mir169o-5p is GRMZM2G165488 [PMC9604548]. GO enrichment analysis revealed that there are 13 pairs of negatively regulated target genes corresponding to miRNAs highly correlated with seed storability. Nine miRNAs were down-regulated (including zma-mir169o-5p) and four were up-regulated (including zma-miR444a) [PMC9604548]. After artificial aging experiments on two inbred lines with differential expression of certain miRNAs including zma-mir169o-5p and zma-miR444a were found to be negatively correlated with seed storability. On the other hand, the expression of miR444a was found to be positively correlated with seed storability [PMC9604548]. The presence of zma-mir169o-5p, zma-miR390a-5p, zma-miR396c, zma-miR444a, zma-miR397b-p5, and novel-miR4 was identified through high-throughput sequencing and these miRNAs may play a regulatory role in seed storability [PMC9604548].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCCAAGAAUGACUUGCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Brachypodium distachyon (stiff brome) bdi-miR169d
  2. Oryza sativa (Asian cultivated rice) osa-miR169n
  3. Oryza sativa Japonica Group microRNA osa-miR169n
  4. Sorghum bicolor (sorghum) sbi-miR169i
Publications