Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-98-3p URS000025E0BB_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-98: Mmu-mir-98 is a microRNA that has been studied in various contexts. In a study, the expression levels of mmu-mir-98, along with other miRNAs, were found to change significantly in inoculated mice, with mmu-mir-98 being downregulated [PMC3767082]. Different mimics and inhibitors were used to manipulate the expression of mmu-mir-98 in mice [PMC5425121]. The concentration of Taqman probe used for mmu-mir-98 was 400 nM [PMC5425121]. Mmu-mir-98 was one of the four selected miRNAs that showed differences in mapping [PMC4051442]. In another study, mmu-mir-98 was found to decrease in activity in dendritic cells after CpG stimulation [PMC6963666]. Mmu-mir-98 was also found to be differentially expressed in OVA-immunized derived offspring group [PMC8234718]. The effects of mmu-mir-98 on foam cell formation and the expression of LOX-1 were studied using macrophages transfected with mimics and inhibitors of mmu-mir-98 [PMC5952997]. Overall, these studies highlight the importance and regulatory role of mmu-mir-98 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAUACAACUUACUACUUUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Cervus elaphus cel-miR-98-3p
  2. Homo sapiens has-miR-mizuguchi-232
Publications