v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Ile secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Ile URS000025B587_559292

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUCGUGUAGCUCAGUGGUUAGAGCUUCGUGCUUAUAGCAACAUUCGGUUUCCGAAGUUUCUGUGCCAAAGACCUUUCAAACAGGCCUUUAAAAGCAACGCGACCGUCGUGGGUUCAAACCCCACCUCGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Saccharomyces cerevisiae AWRI796 tRNA
  2. Saccharomyces cerevisiae tRNA-Ile gene, anticodon tat, potential intron between positions 6535 and 6594, length = 133
  3. Saccharomyces cerevisiae EC1118 tRNA-Ile
  4. Saccharomyces cerevisiae FostersB tRNA
  5. Saccharomyces cerevisiae FostersO tRNA
  6. Saccharomyces cerevisiae Lalvin QA23 tRNA
  7. Saccharomyces cerevisiae RM11-1a tRNA-Ile
  8. Saccharomyces cerevisiae Vin13 tRNA
  9. Saccharomyces cerevisiae VL3 tRNA
  10. Saccharomyces pastorianus tRNA-Ile
 2D structure Publications