v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Crassostrea angulata (Portuguese oyster) transfer RNA alanine (anticodon UGC) secondary structure diagram

Crassostrea angulata (Portuguese oyster) transfer RNA alanine (anticodon UGC) URS0000258B4F_558553

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGAUGUAGCUCAGUGGUAGAGCGCUCGCUUUGCAUGUGAGAGGCCCCGGGUUCGAUCCCCGGCAUCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Crassostrea gigas (Pacific oyster) tRNA
  2. Crassostrea virginica tRNA-Ala
  3. Drosophila melanogaster transfer RNA:Alanine-TGC 1-1 (Dmel_CR30232)
  4. Drosophila sechellia tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  5. Drosophila simulans tRNA-Ala (TGC) (tRNA-Ala-TGC-1-1)
  6. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015024685.1
  7. Ostrea edulis (European flat oyster) transfer RNA alanine (anticodon UGC)
  8. Penaeus chinensis (Fleshy prawn) tRNA-Ala
  9. Penaeus japonicus (Kuruma shrimp) tRNA-Ala
  10. Penaeus vannamei tRNA-Ala
 2D structure Publications