Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Ser secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Ser URS000025778A_559292

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCAACUUGGCCGAGUGGUUAAGGCGAAAGAUUAGAAAUCUUUUGGGCUUUGCCCGCGCAGGUUCGAGUCCUGCAGUUGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 133 other species

  1. Fusarium falciforme tRNA-Ser
  2. Kazachstania bulderi transfer RNA-Ser(AGA)
  3. Naumovozyma castellii CBS 4309 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  4. Naumovozyma dairenensis CBS 421 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 9)
  5. Saccharomyces boulardii (nom. inval.) tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 10)
  6. Saccharomyces cerevisiae AWRI796 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  7. Saccharomyces cerevisiae (baker's yeast) tRNA
  8. Saccharomyces cerevisiae CBS 7960 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 10)
  9. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 10)
  10. Saccharomyces cerevisiae CLIB215 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  11. Saccharomyces cerevisiae CLIB324 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  12. Saccharomyces cerevisiae CLIB382 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 6)
  13. Saccharomyces cerevisiae EC1118 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  14. Saccharomyces cerevisiae EC9-8 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 10)
  15. Saccharomyces cerevisiae FL100 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 13)
  16. Saccharomyces cerevisiae FostersB tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  17. Saccharomyces cerevisiae FostersO tRNA
  18. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 10)
  19. Saccharomyces cerevisiae Lalvin QA23 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  20. Saccharomyces cerevisiae P283 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 9)
  21. Saccharomyces cerevisiae P301 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 10)
  22. Saccharomyces cerevisiae PE-2 tRNA-Ser
  23. Saccharomyces cerevisiae PW5 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7)
  24. Saccharomyces cerevisiae R008 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7)
  25. Saccharomyces cerevisiae R103 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 9)
  26. Saccharomyces cerevisiae RM11-1a tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  27. Saccharomyces cerevisiae Sigma1278b tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  28. Saccharomyces cerevisiae T73 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 7)
  29. Saccharomyces cerevisiae T7 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  30. Saccharomyces cerevisiae UC5 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 9)
  31. Saccharomyces cerevisiae UFMG A-905 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  32. Saccharomyces cerevisiae Vin13 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 10)
  33. Saccharomyces cerevisiae VL3 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 10)
  34. Saccharomyces cerevisiae W303 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  35. Saccharomyces cerevisiae Y10 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 6)
  36. Saccharomyces cerevisiae YJM1078 tRNA-Ser
  37. Saccharomyces cerevisiae YJM1083 tRNA-Ser
  38. Saccharomyces cerevisiae YJM1129 tRNA-Ser
  39. Saccharomyces cerevisiae YJM1133 tRNA-Ser
  40. Saccharomyces cerevisiae YJM1190 tRNA-Ser
  41. Saccharomyces cerevisiae YJM1199 tRNA-Ser
  42. Saccharomyces cerevisiae YJM1202 tRNA-Ser
  43. Saccharomyces cerevisiae YJM1208 tRNA-Ser
  44. Saccharomyces cerevisiae YJM1242 tRNA-Ser
  45. Saccharomyces cerevisiae YJM1244 tRNA-Ser
  46. Saccharomyces cerevisiae YJM1248 tRNA-Ser
  47. Saccharomyces cerevisiae YJM1250 tRNA-Ser
  48. Saccharomyces cerevisiae YJM1252 tRNA-Ser
  49. Saccharomyces cerevisiae YJM1273 tRNA-Ser
  50. Saccharomyces cerevisiae YJM1304 tRNA-Ser
  51. Saccharomyces cerevisiae YJM1307 tRNA-Ser
  52. Saccharomyces cerevisiae YJM1311 tRNA-Ser
  53. Saccharomyces cerevisiae YJM1326 tRNA-Ser
  54. Saccharomyces cerevisiae YJM1332 tRNA-Ser
  55. Saccharomyces cerevisiae YJM1336 tRNA-Ser
  56. Saccharomyces cerevisiae YJM1338 tRNA-Ser
  57. Saccharomyces cerevisiae YJM1341 tRNA-Ser
  58. Saccharomyces cerevisiae YJM1342 tRNA-Ser
  59. Saccharomyces cerevisiae YJM1355 tRNA-Ser
  60. Saccharomyces cerevisiae YJM1356 tRNA-Ser
  61. Saccharomyces cerevisiae YJM1381 tRNA-Ser
  62. Saccharomyces cerevisiae YJM1383 tRNA-Ser
  63. Saccharomyces cerevisiae YJM1385 tRNA-Ser
  64. Saccharomyces cerevisiae YJM1386 tRNA-Ser
  65. Saccharomyces cerevisiae YJM1387 tRNA-Ser
  66. Saccharomyces cerevisiae YJM1388 tRNA-Ser
  67. Saccharomyces cerevisiae YJM1389 tRNA-Ser
  68. Saccharomyces cerevisiae YJM1399 tRNA-Ser
  69. Saccharomyces cerevisiae YJM1400 tRNA-Ser
  70. Saccharomyces cerevisiae YJM1401 tRNA-Ser
  71. Saccharomyces cerevisiae YJM1402 tRNA-Ser
  72. Saccharomyces cerevisiae YJM1415 tRNA-Ser
  73. Saccharomyces cerevisiae YJM1417 tRNA-Ser
  74. Saccharomyces cerevisiae YJM1418 tRNA-Ser
  75. Saccharomyces cerevisiae YJM1419 tRNA-Ser
  76. Saccharomyces cerevisiae YJM1433 tRNA-Ser
  77. Saccharomyces cerevisiae YJM1434 tRNA-Ser
  78. Saccharomyces cerevisiae YJM1439 tRNA-Ser
  79. Saccharomyces cerevisiae YJM1443 tRNA-Ser
  80. Saccharomyces cerevisiae YJM1444 tRNA-Ser
  81. Saccharomyces cerevisiae YJM1447 tRNA-Ser
  82. Saccharomyces cerevisiae YJM1450 tRNA-Ser
  83. Saccharomyces cerevisiae YJM1460 tRNA-Ser
  84. Saccharomyces cerevisiae YJM1463 tRNA-Ser
  85. Saccharomyces cerevisiae YJM1477 tRNA-Ser
  86. Saccharomyces cerevisiae YJM1478 tRNA-Ser
  87. Saccharomyces cerevisiae YJM1479 tRNA-Ser
  88. Saccharomyces cerevisiae YJM1526 tRNA-Ser
  89. Saccharomyces cerevisiae YJM1527 tRNA-Ser
  90. Saccharomyces cerevisiae YJM1549 tRNA-Ser
  91. Saccharomyces cerevisiae YJM1573 tRNA-Ser
  92. Saccharomyces cerevisiae YJM1574 tRNA-Ser
  93. Saccharomyces cerevisiae YJM1592 tRNA-Ser
  94. Saccharomyces cerevisiae YJM1615 tRNA-Ser
  95. Saccharomyces cerevisiae YJM189 tRNA-Ser
  96. Saccharomyces cerevisiae YJM193 tRNA-Ser
  97. Saccharomyces cerevisiae YJM195 tRNA-Ser
  98. Saccharomyces cerevisiae YJM244 tRNA-Ser
  99. Saccharomyces cerevisiae YJM248 tRNA-Ser
  100. Saccharomyces cerevisiae YJM269 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 11)
  101. Saccharomyces cerevisiae YJM270 tRNA-Ser
  102. Saccharomyces cerevisiae YJM271 tRNA-Ser
  103. Saccharomyces cerevisiae YJM320 tRNA-Ser
  104. Saccharomyces cerevisiae YJM326 tRNA-Ser
  105. Saccharomyces cerevisiae YJM428 tRNA-Ser
  106. Saccharomyces cerevisiae YJM450 tRNA-Ser
  107. Saccharomyces cerevisiae YJM451 tRNA-Ser
  108. Saccharomyces cerevisiae YJM453 tRNA-Ser
  109. Saccharomyces cerevisiae YJM456 tRNA-Ser
  110. Saccharomyces cerevisiae YJM470 tRNA-Ser
  111. Saccharomyces cerevisiae YJM541 tRNA-Ser
  112. Saccharomyces cerevisiae YJM554 tRNA-Ser
  113. Saccharomyces cerevisiae YJM555 tRNA-Ser
  114. Saccharomyces cerevisiae YJM627 tRNA-Ser
  115. Saccharomyces cerevisiae YJM681 tRNA-Ser
  116. Saccharomyces cerevisiae YJM682 tRNA-Ser
  117. Saccharomyces cerevisiae YJM683 tRNA-Ser
  118. Saccharomyces cerevisiae YJM689 tRNA-Ser
  119. Saccharomyces cerevisiae YJM693 tRNA-Ser
  120. Saccharomyces cerevisiae YJM969 tRNA-Ser
  121. Saccharomyces cerevisiae YJM972 tRNA-Ser
  122. Saccharomyces cerevisiae YJM975 tRNA-Ser
  123. Saccharomyces cerevisiae YJM978 tRNA-Ser
  124. Saccharomyces cerevisiae YJM981 tRNA-Ser
  125. Saccharomyces cerevisiae YJM984 tRNA-Ser
  126. Saccharomyces cerevisiae YJM987 tRNA-Ser
  127. Saccharomyces cerevisiae YJM990 tRNA-Ser
  128. Saccharomyces cerevisiae YJM993 tRNA-Ser
  129. Saccharomyces cerevisiae YJM996 tRNA-Ser
  130. Saccharomyces cerevisiae YJSH1 tRNA-Ser (AGA) (tRNA-Ser-AGA-1 1 to 8)
  131. Saccharomyces mikatae IFO 1815 tRNA-Ser
  132. Saccharomyces pastorianus tRNA-Ser
  133. Vector YCy2508 tRNA-Ser
2D structure Publications