Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-570-3p URS0000250A40_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-570: Hsa-mir-570 is a microRNA that has been studied in various contexts. It has been included in Taqman MicroRNA assays used for cDNA amplification [PMC5045398]. SNPs in hsa-mir-570 have been found to not affect their cleavage site [PMC3851333]. Additionally, hsa-mir-570 has been used as a TaqMan assay in the study of various genes and microRNAs [PMC6338629]. It has also been found to correlate with certain variants, such as rs4143815, which is associated with hsa-miR-1252, hsa-miR-1253, hsa-miR-539, and hsa-miR-548 [PMC7894801]. Hsa-mir-570 has also been found to be oppositely regulated between certain subgroups [PMC4206873]. In the context of cancer research, it has been identified as a candidate driver microRNA with recurrent copy number gains [PMC4222074]. Furthermore, it has been included in a list of microRNAs associated with poor prognosis in breast cancer [PMC4822961]. Hsa-mir-570 is also part of a miRNA network that is up-regulated in poor prognosis and implicated in the cell cycle [PMC8004706]. In the study of gallbladder cancer patients, gene-gene interactions involving hsa-mir-570 have shown predictive value for susceptibility and treatment response [PMC5223017].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGAAAACAGCAAUUACCUUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications