Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Arginine tRNA (tRNA-Arg), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Arginine tRNA (tRNA-Arg), predicted by tRNAscan-SE analysis URS0000246DB7_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (Rfam, GtRNAdb, ENA, SGD, IntAct). Described in 46 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Arginine tRNA (tRNA-Arg), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Arg-TCT-1-11, tRNA-Arg-TCT-1-2, tRNA-Arg-TCT-1-9, tRNA-Arg-TCT-1-6, tRNA-Arg-TCT-1-3, tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-10, tRNA-Arg-TCT-1-8, tRNA-Arg-TCT-1-5, tRNA-Arg-TCT-1-4, tRNA-Arg-TCT-1-7 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCUCGCGUGGCGUAAUGGCAACGCGUCUGACUUCUAAUCAGAAGAUUAUGGGUUCGACCCCCAUCGUGAGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 146 other species

    1. Blumeria graminis f. sp. tritici 94202 tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
    2. [Candida] glabrata CBS 138 tRNA
    3. [Candida] glabrata tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 8)
    4. Drosophila simulans tRNA
    5. Halorubrum sp. SP9 tRNA-Arg
    6. Pseudoalteromonas piscicida tRNA-Arg
    7. Saccharomyces arboricola H-6 tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
    8. Saccharomyces boulardii (nom. inval.) tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 12)
    9. Saccharomyces cerevisiae AWRI796 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    10. Saccharomyces cerevisiae (baker's yeast) tRNA-Arg gene, anticodon tct, len: 72
    11. Saccharomyces cerevisiae CBS 7960 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    12. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    13. Saccharomyces cerevisiae CLIB215 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    14. Saccharomyces cerevisiae CLIB324 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    15. Saccharomyces cerevisiae CLIB382 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 4)
    16. Saccharomyces cerevisiae EC1118 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    17. Saccharomyces cerevisiae EC9-8 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    18. Saccharomyces cerevisiae FL100 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 12)
    19. Saccharomyces cerevisiae FostersB tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    20. Saccharomyces cerevisiae FostersO tRNA
    21. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    22. Saccharomyces cerevisiae Lalvin QA23 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    23. Saccharomyces cerevisiae P283 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 9)
    24. Saccharomyces cerevisiae P301 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    25. Saccharomyces cerevisiae PE-2 tRNA-Arg
    26. Saccharomyces cerevisiae PW5 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 6)
    27. Saccharomyces cerevisiae R008 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    28. Saccharomyces cerevisiae R103 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    29. Saccharomyces cerevisiae RM11-1a tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    30. Saccharomyces cerevisiae Sigma1278b tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    31. Saccharomyces cerevisiae T73 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 9)
    32. Saccharomyces cerevisiae T7 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    33. Saccharomyces cerevisiae UC5 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 4)
    34. Saccharomyces cerevisiae UFMG A-905 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    35. Saccharomyces cerevisiae Vin13 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 10)
    36. Saccharomyces cerevisiae VL3 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    37. Saccharomyces cerevisiae W303 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    38. Saccharomyces cerevisiae Y10 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 9)
    39. Saccharomyces cerevisiae YJM1078 tRNA-Arg
    40. Saccharomyces cerevisiae YJM1083 tRNA-Arg
    41. Saccharomyces cerevisiae YJM1129 tRNA-Arg
    42. Saccharomyces cerevisiae YJM1133 tRNA-Arg
    43. Saccharomyces cerevisiae YJM1190 tRNA-Arg
    44. Saccharomyces cerevisiae YJM1199 tRNA-Arg
    45. Saccharomyces cerevisiae YJM1202 tRNA-Arg
    46. Saccharomyces cerevisiae YJM1208 tRNA-Arg
    47. Saccharomyces cerevisiae YJM1242 tRNA-Arg
    48. Saccharomyces cerevisiae YJM1244 tRNA-Arg
    49. Saccharomyces cerevisiae YJM1248 tRNA-Arg
    50. Saccharomyces cerevisiae YJM1250 tRNA-Arg
    51. Saccharomyces cerevisiae YJM1252 tRNA-Arg
    52. Saccharomyces cerevisiae YJM1273 tRNA-Arg
    53. Saccharomyces cerevisiae YJM1304 tRNA-Arg
    54. Saccharomyces cerevisiae YJM1307 tRNA-Arg
    55. Saccharomyces cerevisiae YJM1311 tRNA-Arg
    56. Saccharomyces cerevisiae YJM1326 tRNA-Arg
    57. Saccharomyces cerevisiae YJM1332 tRNA-Arg
    58. Saccharomyces cerevisiae YJM1336 tRNA-Arg
    59. Saccharomyces cerevisiae YJM1338 tRNA-Arg
    60. Saccharomyces cerevisiae YJM1341 tRNA-Arg
    61. Saccharomyces cerevisiae YJM1342 tRNA-Arg
    62. Saccharomyces cerevisiae YJM1355 tRNA-Arg
    63. Saccharomyces cerevisiae YJM1356 tRNA-Arg
    64. Saccharomyces cerevisiae YJM1381 tRNA-Arg
    65. Saccharomyces cerevisiae YJM1383 tRNA-Arg
    66. Saccharomyces cerevisiae YJM1385 tRNA-Arg
    67. Saccharomyces cerevisiae YJM1386 tRNA-Arg
    68. Saccharomyces cerevisiae YJM1387 tRNA-Arg
    69. Saccharomyces cerevisiae YJM1388 tRNA-Arg
    70. Saccharomyces cerevisiae YJM1389 tRNA-Arg
    71. Saccharomyces cerevisiae YJM1399 tRNA-Arg
    72. Saccharomyces cerevisiae YJM1400 tRNA-Arg
    73. Saccharomyces cerevisiae YJM1401 tRNA-Arg
    74. Saccharomyces cerevisiae YJM1402 tRNA-Arg
    75. Saccharomyces cerevisiae YJM1415 tRNA-Arg
    76. Saccharomyces cerevisiae YJM1417 tRNA-Arg
    77. Saccharomyces cerevisiae YJM1418 tRNA-Arg
    78. Saccharomyces cerevisiae YJM1419 tRNA-Arg
    79. Saccharomyces cerevisiae YJM1433 tRNA-Arg
    80. Saccharomyces cerevisiae YJM1434 tRNA-Arg
    81. Saccharomyces cerevisiae YJM1439 tRNA-Arg
    82. Saccharomyces cerevisiae YJM1443 tRNA-Arg
    83. Saccharomyces cerevisiae YJM1444 tRNA-Arg
    84. Saccharomyces cerevisiae YJM1447 tRNA-Arg
    85. Saccharomyces cerevisiae YJM1450 tRNA-Arg
    86. Saccharomyces cerevisiae YJM1460 tRNA-Arg
    87. Saccharomyces cerevisiae YJM1463 tRNA-Arg
    88. Saccharomyces cerevisiae YJM1477 tRNA-Arg
    89. Saccharomyces cerevisiae YJM1478 tRNA-Arg
    90. Saccharomyces cerevisiae YJM1479 tRNA-Arg
    91. Saccharomyces cerevisiae YJM1526 tRNA-Arg
    92. Saccharomyces cerevisiae YJM1527 tRNA-Arg
    93. Saccharomyces cerevisiae YJM1549 tRNA-Arg
    94. Saccharomyces cerevisiae YJM1573 tRNA-Arg
    95. Saccharomyces cerevisiae YJM1574 tRNA-Arg
    96. Saccharomyces cerevisiae YJM1592 tRNA-Arg
    97. Saccharomyces cerevisiae YJM1615 tRNA-Arg
    98. Saccharomyces cerevisiae YJM189 tRNA-Arg
    99. Saccharomyces cerevisiae YJM193 tRNA-Arg
    100. Saccharomyces cerevisiae YJM195 tRNA-Arg
    101. Saccharomyces cerevisiae YJM244 tRNA-Arg
    102. Saccharomyces cerevisiae YJM248 tRNA-Arg
    103. Saccharomyces cerevisiae YJM269 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    104. Saccharomyces cerevisiae YJM270 tRNA-Arg
    105. Saccharomyces cerevisiae YJM271 tRNA-Arg
    106. Saccharomyces cerevisiae YJM320 tRNA-Arg
    107. Saccharomyces cerevisiae YJM326 tRNA-Arg
    108. Saccharomyces cerevisiae YJM428 tRNA-Arg
    109. Saccharomyces cerevisiae YJM450 tRNA-Arg
    110. Saccharomyces cerevisiae YJM451 tRNA-Arg
    111. Saccharomyces cerevisiae YJM453 tRNA-Arg
    112. Saccharomyces cerevisiae YJM456 tRNA-Arg
    113. Saccharomyces cerevisiae YJM470 tRNA-Arg
    114. Saccharomyces cerevisiae YJM541 tRNA-Arg
    115. Saccharomyces cerevisiae YJM554 tRNA-Arg
    116. Saccharomyces cerevisiae YJM555 tRNA-Arg
    117. Saccharomyces cerevisiae YJM627 tRNA-Arg
    118. Saccharomyces cerevisiae YJM681 tRNA-Arg
    119. Saccharomyces cerevisiae YJM682 tRNA-Arg
    120. Saccharomyces cerevisiae YJM683 tRNA-Arg
    121. Saccharomyces cerevisiae YJM689 tRNA-Arg
    122. Saccharomyces cerevisiae YJM693 tRNA-Arg
    123. Saccharomyces cerevisiae YJM969 tRNA-Arg
    124. Saccharomyces cerevisiae YJM972 tRNA-Arg
    125. Saccharomyces cerevisiae YJM975 tRNA-Arg
    126. Saccharomyces cerevisiae YJM978 tRNA-Arg
    127. Saccharomyces cerevisiae YJM981 tRNA-Arg
    128. Saccharomyces cerevisiae YJM984 tRNA-Arg
    129. Saccharomyces cerevisiae YJM987 tRNA-Arg
    130. Saccharomyces cerevisiae YJM990 tRNA-Arg
    131. Saccharomyces cerevisiae YJM993 tRNA-Arg
    132. Saccharomyces cerevisiae YJM996 tRNA-Arg
    133. Saccharomyces cerevisiae YJSH1 tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 11)
    134. Saccharomyces eubayanus tRNA-Arg
    135. Saccharomyces kudriavzevii IFO 1802 tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2)
    136. Saccharomyces pastorianus tRNA-Arg
    2D structure New