Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-885 URS0000246356_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-885: Bta-mir-885 is a microRNA that has been studied in both rats and bovine species. In rats, only two miRNAs, including bta-mir-885, were found to be significantly different between two treatments (ERS > ERD) in the gastrocnemius muscle [PMC6476979]. However, it is unlikely that the differences in bovine miRNAs between diets contributed to the gastrocnemius transcriptome signature in rats [PMC6476979]. In Japanese black cattle, bta-mir-885 was found to target the MTDH gene, which was exclusively expressed in the semitendinosus muscle [PMC7140828]. This finding was consistent with a previous study that also identified MTDH as a target gene for bta-mir-885 and showed its exclusive expression in semitendinosus muscle [PMC6317189]. The target genes for three miRNAs (bta-mir-885, bta-miR-423-3p, and bta-miR-2284x) were not obtainable due to limitations of available programs [PMC3806118]. Bta-mir-885 has been shown to be down-regulated in various studies. For example, it was one of the most down-regulated miRNAs compared to control conditions [PMC5821052]. Additionally, its expression was found to be differentially regulated by dietary supplementation with SFO and LSO in relation to milk yield and milk components [PMC6164576].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAUUACACUACCCUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-885
  2. Canis lupus familiaris cfa-miR-885
  3. Dasypus novemcinctus dno-miR-885-5p
  4. Equus caballus eca-miR-885-5p
  5. Homo sapiens (human) hsa-miR-885-5p
  6. Macaca mulatta (Rhesus monkey) mml-miR-885-5p
  7. Oryctolagus cuniculus ocu-miR-885-5p
  8. Pongo pygmaeus (Bornean orangutan) ppy-miR-885-5p
  9. Pteropus alecto pal-miR-885-5p
  10. Sus scrofa (pig) ssc-miR-885-5p
Publications