v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cercocebus atys (Sooty mangabey) microRNA 221 (ENSCATG00000019377.1) secondary structure diagram

Cercocebus atys (Sooty mangabey) microRNA 221 (ENSCATG00000019377.1) URS0000245997_9531

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAACAUCCAGGUCUGGGGCAUGAACCUGGCAUACAAUGUAGAUUUCUGUGUUCGUUAGGCAACAGCUACAUUGUCUGCUGGGUUUCAGGCUACCUGGAAACAUGUUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Chlorocebus sabaeus (African green monkey) microRNA 221 (ENSCSAG00000025939.1)
  2. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000013275.1)
  3. Gorilla gorilla gorilla ggo-mir-221 (ENSGGOG00000030342.2)
  4. Gorilla gorilla microRNA ggo-mir-221 precursor
  5. Homo sapiens (human) microRNA hsa-mir-221 precursor
  6. Macaca fascicularis (Crab-eating macaque) miRNA (ENSMFAG00000005619.2, ENSMFAG00000047414.1)
  7. Macaca mulatta (Rhesus monkey) microRNA mml-mir-221 precursor
  8. Macaca nemestrina (Pig-tailed macaque) microRNA 221 (ENSMNEG00000017548.1)
  9. Mandrillus leucophaeus (Drill) microRNA 221 (ENSMLEG00000010311.1)
  10. Pan paniscus microRNA ppa-mir-221 precursor
  11. Pan troglodytes ptr-mir-221 (ENSPTRG00000027606.2, ENSPTRG00000052522.1)
  12. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 221 (ENSPTEG00000012929.1)
  13. Pongo abelii (Sumatran orangutan) microRNA 221 (ENSPPYG00000021896.2)
  14. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-221 precursor
  15. Theropithecus gelada (gelada) microRNA 221 (ENSTGEG00000006496.1)
 2D structure Publications