Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-29b-3p URS000024463E_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (miRBase, GeneCards, MalaCards, MirGeneDB, TarBase, ENA, LncBase, RefSeq). Described in 111 papers. Homo sapiens (human) hsa-miR-29b-3p sequence is a product of hsa-miR-29b, hsa-miR-29b-3p, MIR29B1, miR-29, 1, miR-29b-3p, 29b-1, MIR29B2, miR-29b genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 182-FIP, 1R20, 2-HPCL, 2F1, 2H9, 2PP2A, 4EHP, 53BP1, 6A3-5, 7A5.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGCACCAUUUGAAAUCAGUGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 36 other species

    1. Alligator mississippiensis Ami-Mir-29-P2b-v1_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-29-P2b-v1_3p (mature (guide))
    3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-29b
    4. Bos taurus (cattle) bta-miR-29b
    5. Callithrix jacchus cja-miR-29b
    6. Callorhinchus milii (elephant shark) eshark_mir-29_3
    7. Canis lupus familiaris cfa-miR-29b
    8. Cavia porcellus (domestic guinea pig) cpo-miR-29b-3p
    9. Chrysemys picta bellii Cpi-Mir-29-P2b-v1_3p (mature (guide))
    10. Columba livia cli-miR-29b-3p
    11. Cricetulus griseus (Chinese hamster) cgr-miR-29b-3p
    12. Cyprinus carpio ccr-miR-29b
    13. Danio rerio (zebrafish) dre-miR-29b3-3p
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29b-3p
    15. Echinops telfairi Ete-Mir-29-P2b-v1_3p (mature (guide))
    16. Equus caballus (horse) eca-miR-29b
    17. Gallus gallus (chicken) gga-miR-29b-3p
    18. Macaca mulatta (Rhesus monkey) mml-miR-29b-3p
    19. Maylandia zebra mze-miR-29b
    20. Microcebus murinus mmr-miR-29b
    21. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-29-P2b-v1_3p (mature (guide))
    22. Mus musculus mmu-miR-29b-3p
    23. Neolamprologus brichardi nbr-miR-29b
    24. Nomascus leucogenys nle-miR-29b
    25. Ophiophagus hannah (king cobra) oha-miR-29b-3p
    26. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P2b-v1_3p (mature (guide))
    27. Oryctolagus cuniculus (rabbit) ocu-miR-29b-3p
    28. Otolemur garnettii oga-miR-29b
    29. Pteropus alecto pal-miR-29b-3p
    30. Rattus norvegicus (Norway rat) rno-miR-29b-3p
    31. Saccoglossus kowalevskii Sko-Mir-29-P2_3p (mature (guide))
    32. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P2b-v1_3p (mature (guide))
    33. Sus scrofa (pig) ssc-miR-29b
    34. Taeniopygia guttata Tgu-Mir-29-P2b-v1_3p (mature (guide))
    35. Tupaia chinensis (Chinese tree shrew) tch-miR-29b-3p
    36. Xenopus laevis (African clawed frog) xla-miR-29b-3p
    37. Xenopus tropicalis xtr-miR-29b