Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Malcolmia africana 5S ribosomal RNA URS0000240B4B_234454

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACCGGGCACUACGGUGAGACGUGAAAACACCCGAUCCCAUUCCGACCUCGAUAUGUGGAAUCGUCUUGCGCCAUAUGUACUGAGAUUGUUCGGGAGACAUGGUCCAAGCCCGGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 62 other species

  1. Actinidia latifolia 5S ribosomal RNA
  2. Actinidia macrosperma 5S ribosomal RNA
  3. Actinidia rufa 5S ribosomal RNA
  4. Actinidia valvata 5S ribosomal RNA
  5. Aeginetia indica 5S ribosomal RNA
  6. Anethum foeniculum 5S ribosomal RNA
  7. Angelica biserrata 5S ribosomal RNA
  8. Angelica dahurica 5S ribosomal RNA
  9. Arabidopsis thaliana rRNA ATMG01380
  10. Artocarpus heterophyllus (jackfruit) 5S ribosomal RNA
  11. Artocarpus integer 5S ribosomal RNA
  12. Asclepias syriaca mitochondrial 5S rRNA
  13. Camellia chekiangoleosa 5S ribosomal RNA
  14. Camellia lanceoleosa 5S ribosomal RNA
  15. Camellia oleifera 5S ribosomal RNA
  16. Capsella bursa-pastoris 5S ribosomal RNA
  17. Capsella rubella 5S ribosomal RNA
  18. Chionanthus retusus 5S ribosomal RNA
  19. Chrysosplenium glossophyllum 5S ribosomal RNA
  20. Chrysosplenium nudicaule 5S ribosomal RNA
  21. Chrysosplenium valdepilosum 5S ribosomal RNA
  22. Citrullus lanatus mitochondrial 5S rRNA
  23. Citrullus lanatus 5S ribosomal RNA
  24. Crucihimalaya lasiocarpa 5S ribosomal RNA
  25. Descurainia sophia 5S ribosomal RNA
  26. Eucalyptus urophylla x Eucalyptus grandis 5S ribosomal RNA
  27. Haloxylon ammodendron 5S ribosomal RNA
  28. Hippophae rhamnoides 5S ribosomal RNA
  29. Hydrangea chinensis 5S ribosomal RNA
  30. Ilex rotunda 5S ribosomal RNA
  31. Jasminum sambac 5S ribosomal RNA
  32. Lagenaria siceraria (white-flowered gourd) 5S ribosomal RNA
  33. Lepidium apetalum 5S ribosomal RNA
  34. Lepidium sativum 5S ribosomal RNA
  35. Lonicera macranthoides 5S ribosomal RNA
  36. Momordica charantia 5S ribosomal RNA
  37. Morus alba (white mulberry) 5S ribosomal RNA
  38. Morus mongolica 5S ribosomal RNA
  39. Morus notabilis 5S ribosomal RNA
  40. Myricaria laxiflora 5S ribosomal RNA
  41. Nopalea cochenillifera 5S ribosomal RNA
  42. Oenanthe linearis 5S ribosomal RNA
  43. Oenanthe thomsonii 5S ribosomal RNA
  44. Oenothera berteroana 5S rRNA
  45. Panax quinquefolius 5S ribosomal RNA
  46. Physaria fendleri (Fendler's bladderpod) 5S ribosomal RNA
  47. Punica granatum (pomegranate) 5S ribosomal RNA
  48. Rhodomyrtus tomentosa 5S ribosomal RNA
  49. Ribes alpinum 5S ribosomal RNA
  50. Ribes meyeri 5S ribosomal RNA
  51. Ribes nigrum 5S ribosomal RNA
  52. Ribes odoratum 5S ribosomal RNA
  53. Ribes stenocarpum 5S ribosomal RNA
  54. Selenicereus monacanthus 5S ribosomal RNA
  55. Spuriopimpinella brachycarpa 5S ribosomal RNA
  56. Stewartia sinensis var. sinensis 5S ribosomal RNA
  57. Syzygium samarangense 5S ribosomal RNA
  58. Tetracme quadricornis 5S ribosomal RNA
  59. Thladiantha cordifolia 5S ribosomal RNA
  60. Tiarella polyphylla 5S ribosomal RNA
  61. Trachelospermum jasminoides 5S ribosomal RNA
  62. Tripterygium wilfordii 5S ribosomal RNA
  63. Vitis vinifera mitochondrial 5S rRNA
Relationships

Molecular Relationships