Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-1931 URS000023F66A_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-1931: Mmu-mir-1931 is a microRNA that has the highest number of single nucleotide polymorphisms (SNPs) among the microRNAs studied, with a total of six SNPs [PMC7113310]. It is also identified as an early-response microRNA, along with mmu-miR-3473e and mmu-miR-5128 [PMC6829453]. In a study, mmu-mir-1931 was found to interact with the genes Peg3 and Cybrd1, while Cybrd1 interacted with mmu-miR-290a-5p and mmu-miR-3082-5p [PMC9283434]. These interactions were observed in common differentially expressed genes (DEGs) [PMC9283434]. Furthermore, miRCURY LNATM miRNA inhibitors or mimics for mmu-mir-1931, mmu-miR-3473e, or mmu-miR-5128 were purchased from Exiqon for experimental purposes [PMC5159803]. qRT-PCR was performed to analyze the expression levels of various microRNAs including mmu-mir-1931 and other control microRNAs [PMC5159803].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGCAAGGGCUGGUGCGAUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications