Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-181d-5p URS0000236310_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAUUGUUGUCGGUGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-181d
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-181d
  3. Canis lupus familiaris cfa-miR-181d
  4. Capra hircus chi-miR-181d
  5. Cricetulus griseus cgr-miR-181d-5p
  6. Gorilla gorilla gorilla ggo-miR-181d (MIR181D)
  7. Gorilla gorilla ggo-miR-181d
  8. Homo sapiens hsa-miR-181d-5p
  9. Macaca mulatta mml-miR-181d
  10. Mus musculus (house mouse) mmu-miR-181d-5p
  11. Otolemur garnettii oga-miR-181d
  12. Pan troglodytes (chimpanzee) ptr-miR-181d
  13. Pongo pygmaeus ppy-miR-181d
  14. Tupaia chinensis tch-miR-181d
Publications