Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-765 URS0000235862_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-765: Hsa-mir-765 is a microRNA that has been identified as part of a novel fulvestrant signaling cascade in prostate cancer [PMC4626151]. This cascade involves the upregulation of hsa-mir-765 by ERb-mediated transcription, which leads to the suppression of HMGA1 protein expression, contributing to the tumor suppressor action of fulvestrant [PMC4626151]. In a study analyzing miRNA expression in prostate cancer, hsa-mir-765 was found to be downregulated and correlated with poor prognosis [PMC8787190]. Another study focused on hepatocellular carcinoma (HCC) found that hsa-mir-765 was one of two miRNAs that affected prognosis in HCC patients [PMC9422102]. Additionally, in melanoma, hsa-mir-765 was identified as the main upregulated miRNA in extracellular vesicles (pEVs) [PMC7706137].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGGAGAAGGAAGGUGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes (chimpanzee) ptr-miR-765
  2. Pongo pygmaeus ppy-miR-765
Publications