Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-27a precursor URS0000233054_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR27A: MIR27A is a microRNA that has been implicated in various biological processes and diseases. Transplantation of lipotoxic HC-exosomal MIR27A has been shown to impair mitochondrial functions and worsen fibrosis in MAFLD [PMC8607138]. In a cellular context, MIR27A, along with other candidate miRs such as miR144, miR153, and miR142-5p, can bind to Nrf2 through multiple distinct binding sites, potentially enhancing the targeting of Nrf2 and its associated functions [PMC3517581]. The influence of variants in MIR27A on the risk of coronary artery disease (CAD) has been evaluated, with rs895819, rs11614913, and rs2168518 variants being investigated [PMC9141586]. MIR27A may also play a role in stem cell and adipocyte differentiation [PMC6158720]. Rosiglitazone treatment was found to decrease the migration of 3T3-L1 preadipocytes compared to MIR27A transfected cells [PMC6158720]. The expression of VEGF and VEGFR1 was evaluated along with key transcription factors (Sp1, Sp3) and microRNAs (miR20a and MIR27A) in response to TA treatment [PMC7168141]. Chloroquine did not affect the processing of miR21 or MIR27A in control cells after pre-treatment [PMC3749859]. In Treg cells with reduced Dicer levels but overexpressed miRNAs such as let-7a, let-7f, miR-16, miR-23a/b, MIR27A, and miR-155 were observed [PMC3072673].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAGGGUCCACACCAAGUCGUGUUCACAGUGGCUAAGUUCCGCCCCCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Publications