Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4709-3p URS000023133F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4709: Hsa-mir-4709 is a microRNA (miRNA) that has been implicated in various biological processes and diseases [PMC7222416]. It has been reported that miRNAs, including hsa-mir-4709, may regulate genes associated with oxidative stress injuries in retinal pigment epithelial (RPE) cells [PMC7222416]. Hsa-mir-4709 is also one of the prognostic target genes in pancreatic ductal adenocarcinoma (PDAC) and has been associated with the opposite trend in PDAC prognosis [PMC6089101]. Additionally, hsa-mir-4709 has been found to be significantly up-regulated in colon cancer and is associated with poor prognosis [PMC7541229]. In a study on colorectal adenocarcinoma (COAD), hsa-mir-4709 was found to be part of a ceRNA regulatory network, where it interacts with lncRNA LINC00115 to regulate the expression of genes such as SIX4, GRAP, NKAIN4, MMAA, and ERVMER34–1 [PMC7541229]. Furthermore, hsa-mir-4709 was identified as one of the optimum prognostic signature DERs (differentially expressed RNAs) in COAD recurrence prediction models [PMC7541229]. Overall, hsa-mir-4709 plays a role in various diseases and biological processes through its regulation of target genes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAAGAGGAGGUGCUCUGUAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications