Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-let-7e-3p URS000022B6DD_8030

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUAUACAAUCUACUGUCUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Capra hircus (goat) chi-let-7a-3p
  2. Cavia porcellus (domestic guinea pig) cpo-let-7a-3p
  3. Columba livia cli-let-7e-3p
  4. Dasypus novemcinctus dno-let-7a-3p
  5. Gadus morhua gmo-let-7e-3p
  6. Gallus gallus (chicken) gga-let-7k-3p
  7. Macaca mulatta (Rhesus monkey) mml-let-7a-3p
  8. Mus musculus (house mouse) mmu-let-7c-2-3p
  9. Ornithorhynchus anatinus oan-let-7e-3p
  10. Oryctolagus cuniculus (rabbit) ocu-let-7a-3p
  11. Pteropus alecto pal-let-7a-3p
  12. Python bivittatus pbv-let-7e-3p
  13. Rattus norvegicus rno-let-7c-2-3p
  14. Taeniopygia guttata tgu-let-7a-1-3p
  15. Tupaia chinensis (Chinese tree shrew) tch-let-7a-3p
  16. Xenopus laevis (African clawed frog) xla-let-7e-3p