Caution, this is an AI generated summary based on literature. This may have errors, see here for more.
Please share your feedback with us.
cel-mir-67: Cel-mir-67 is a miRNA in Caenorhabditis elegans that is commonly used as a negative control in miRNA research due to its minimal sequence homology with mouse, rat, and human miRNAs [PMC7993499]. In a study, cells were transfected with various RNA molecules, including cel-mir-67 hairpin inhibitors [PMC4104030]. Another study used a biotinylated cel-mir-67 duplex control construct to investigate its binding to Tgfb2 and Smad2 mRNAs [PMC8361274]. The mature sequence of cel-mir-67 mimic is UCACAACCUCCUAGAAAGAGUAGA, while the mature sequence of the cel-mir-67 inhibitor is UCUACUCUUUCUAGGAGGUUGUGA [PMC5613373]. In miRNA target prediction, synthetic mimics of miR-135a-5p and the non-targeting negative control cel-mir-67 were obtained from GE Healthcare [PMC5540823]. Cel-mir-67 serves as an important control in miRNA research due to its distinct sequence from other known miRNAs in various species.
Genome locations
Gene Ontology annotations
Ancestor Chart
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset
