Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-9a-3p URS00002293E8_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-9a: Bmo-mir-9a is a conservative miRNA [PMC4222307]. Over-expression of bmo-mir-9a, bmo-miR-14, and bmo-miR-2766 resulted in a significant decrease in the relative expression of the reporter gene, Renilla luciferase [PMC3535529]. The precursors of bmo-miR-14, bmo-miR-2766, and bmo-mir-9a were amplified from the B. mori genome DNA and inserted into pmR-mCherry for miRNA expression [PMC3535529]. Using qRT-PCR, it was confirmed that bmo-mir-9a was down-regulated in sequence data along with other miRNAs [PMC3699532]. Bmo-miR-8, bmo-mir-9a, and bmo-miR-263a showed a slight elevation after the diapause-broken stage and maintained a relatively constant level thereafter [PMC2500172]. The down-regulation of Bmase gene expression was attributed to the regulation function of bmo-mir-9a [PMC4222307]. A target-binding site for bmo-mir-9a was identified in the 3'UTR of Bmase gene [PMC4222307]. Co-transfection experiments with synthetic mimics of bmo-mir-9a and Bmase 3'UTR fused luciferase reporter plasmid confirmed these results [PMC4222307]. A vector over-expressing bmo-mir 9-a and a reporter plasmid with Bmase 3'UTR fused to firefly luciferase gene were constructed to further verify the regulation function of bno mir 9-a on Bmase gene expression. These findings highlight the role of mir 9-a in down-regulating Bmase gene expression [PMC4222307].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAAAGCUAGGUUACCGGAGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Dinoponera quadriceps dqu-miR-9-3p
  2. Manduca sexta (tobacco hornworm) mse-miR-9b
Publications