Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS000022816F_559292

Automated summary: This snoRNA sequence is 88 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (IntAct, RefSeq, ENA, SGD). Described in 38 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR77, RF01181). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR77 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 5

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-15097623 URS00005F2C2D_559292 EBI-10821373 URS00005F2C2D_559292 rrna 18s yeast
EBI-10960799 URS00004BEF81_559292 EBI-10821555 URS00004BEF81_559292 rrna 35s yeast
EBI-10921892 P15646 D2870 D6VRX5 EBI-6838 Histone-glutamine methyltransferase LOT3 NOP1 P15646 P89890 U3 small nucleolar RNA-associated protein NOP1 YDL014W fbrl_yeast
EBI-16764039 P38996 D6W3H8 EBI-11776 HMD1 NAB3 P38996 Q07034 YPL190C nab3_yeast
EBI-16640615 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUCAUAUGAUGAUUAUAACAAAAACAAAAGCUGGAAUUACUGGCUGAACGAGUAUAUGUUGAUACGUUUUUGCACUAUCCUGACCUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 98 other species

    1. Saccharomyces cerevisiae small nucleolar RNA snR77
    2. Saccharomyces cerevisiae EC1118 SNR77
    3. Saccharomyces cerevisiae Kyokai no. 7 K7_snR77
    4. Saccharomyces cerevisiae P301 SNR77
    5. Saccharomyces cerevisiae PE-2 SNR77
    6. Saccharomyces cerevisiae R008 SNR77
    7. Saccharomyces cerevisiae R103 SNR77
    8. Saccharomyces cerevisiae YJM1078 SNR77
    9. Saccharomyces cerevisiae YJM1083 SNR77
    10. Saccharomyces cerevisiae YJM1129 SNR77
    11. Saccharomyces cerevisiae YJM1133 SNR77
    12. Saccharomyces cerevisiae YJM1190 SNR77
    13. Saccharomyces cerevisiae YJM1199 SNR77
    14. Saccharomyces cerevisiae YJM1202 SNR77
    15. Saccharomyces cerevisiae YJM1208 SNR77
    16. Saccharomyces cerevisiae YJM1242 SNR77
    17. Saccharomyces cerevisiae YJM1244 SNR77
    18. Saccharomyces cerevisiae YJM1248 SNR77
    19. Saccharomyces cerevisiae YJM1250 SNR77
    20. Saccharomyces cerevisiae YJM1252 SNR77
    21. Saccharomyces cerevisiae YJM1273 SNR77
    22. Saccharomyces cerevisiae YJM1304 SNR77
    23. Saccharomyces cerevisiae YJM1307 SNR77
    24. Saccharomyces cerevisiae YJM1311 SNR77
    25. Saccharomyces cerevisiae YJM1326 SNR77
    26. Saccharomyces cerevisiae YJM1332 SNR77
    27. Saccharomyces cerevisiae YJM1336 SNR77
    28. Saccharomyces cerevisiae YJM1338 SNR77
    29. Saccharomyces cerevisiae YJM1341 SNR77
    30. Saccharomyces cerevisiae YJM1342 SNR77
    31. Saccharomyces cerevisiae YJM1355 SNR77
    32. Saccharomyces cerevisiae YJM1356 SNR77
    33. Saccharomyces cerevisiae YJM1381 SNR77
    34. Saccharomyces cerevisiae YJM1383 SNR77
    35. Saccharomyces cerevisiae YJM1385 SNR77
    36. Saccharomyces cerevisiae YJM1386 SNR77
    37. Saccharomyces cerevisiae YJM1387 SNR77
    38. Saccharomyces cerevisiae YJM1388 SNR77
    39. Saccharomyces cerevisiae YJM1389 SNR77
    40. Saccharomyces cerevisiae YJM1399 SNR77
    41. Saccharomyces cerevisiae YJM1400 SNR77
    42. Saccharomyces cerevisiae YJM1401 SNR77
    43. Saccharomyces cerevisiae YJM1402 SNR77
    44. Saccharomyces cerevisiae YJM1415 SNR77
    45. Saccharomyces cerevisiae YJM1417 SNR77
    46. Saccharomyces cerevisiae YJM1418 SNR77
    47. Saccharomyces cerevisiae YJM1419 SNR77
    48. Saccharomyces cerevisiae YJM1433 SNR77
    49. Saccharomyces cerevisiae YJM1434 SNR77
    50. Saccharomyces cerevisiae YJM1439 SNR77
    51. Saccharomyces cerevisiae YJM1443 SNR77
    52. Saccharomyces cerevisiae YJM1444 SNR77
    53. Saccharomyces cerevisiae YJM1450 SNR77
    54. Saccharomyces cerevisiae YJM1460 SNR77
    55. Saccharomyces cerevisiae YJM1463 SNR77
    56. Saccharomyces cerevisiae YJM1477 SNR77
    57. Saccharomyces cerevisiae YJM1478 SNR77
    58. Saccharomyces cerevisiae YJM1479 SNR77
    59. Saccharomyces cerevisiae YJM1526 SNR77
    60. Saccharomyces cerevisiae YJM1527 SNR77
    61. Saccharomyces cerevisiae YJM1549 SNR77
    62. Saccharomyces cerevisiae YJM1573 SNR77
    63. Saccharomyces cerevisiae YJM1574 SNR77
    64. Saccharomyces cerevisiae YJM1592 SNR77
    65. Saccharomyces cerevisiae YJM1615 SNR77
    66. Saccharomyces cerevisiae YJM189 SNR77
    67. Saccharomyces cerevisiae YJM193 SNR77
    68. Saccharomyces cerevisiae YJM195 SNR77
    69. Saccharomyces cerevisiae YJM244 SNR77
    70. Saccharomyces cerevisiae YJM248 SNR77
    71. Saccharomyces cerevisiae YJM270 SNR77
    72. Saccharomyces cerevisiae YJM271 SNR77
    73. Saccharomyces cerevisiae YJM320 SNR77
    74. Saccharomyces cerevisiae YJM326 SNR77
    75. Saccharomyces cerevisiae YJM428 SNR77
    76. Saccharomyces cerevisiae YJM450 SNR77
    77. Saccharomyces cerevisiae YJM451 SNR77
    78. Saccharomyces cerevisiae YJM453 SNR77
    79. Saccharomyces cerevisiae YJM456 SNR77
    80. Saccharomyces cerevisiae YJM470 SNR77
    81. Saccharomyces cerevisiae YJM541 SNR77
    82. Saccharomyces cerevisiae YJM554 SNR77
    83. Saccharomyces cerevisiae YJM555 SNR77
    84. Saccharomyces cerevisiae YJM627 SNR77
    85. Saccharomyces cerevisiae YJM682 SNR77
    86. Saccharomyces cerevisiae YJM683 SNR77
    87. Saccharomyces cerevisiae YJM689 SNR77
    88. Saccharomyces cerevisiae YJM693 SNR77
    89. Saccharomyces cerevisiae YJM969 SNR77
    90. Saccharomyces cerevisiae YJM972 SNR77
    91. Saccharomyces cerevisiae YJM975 SNR77
    92. Saccharomyces cerevisiae YJM978 SNR77
    93. Saccharomyces cerevisiae YJM981 SNR77
    94. Saccharomyces cerevisiae YJM984 SNR77
    95. Saccharomyces cerevisiae YJM987 SNR77
    96. Saccharomyces cerevisiae YJM990 SNR77
    97. Saccharomyces cerevisiae YJM993 SNR77
    98. Saccharomyces cerevisiae YJM996 SNR77
    2D structure New