Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-5193 URS0000224AEA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-5193: Based on TCGA data, hsa-mir-5193 and hsa-miR-1343-3p showed weak and negative correlation with DUOX2 in pancreatic cancer (PC) [PMC7943273]. These microRNAs have also been found to be negatively associated with overall survival (OS) in PC patients [PMC7943273]. The putative binding sites of hsa-mir-5193 and hsa-miR-1343-3p in DUOX2 3′UTR have been identified [PMC7943273]. High expression of hsa-mir-5193 and hsa-miR-1343-3p has been associated with favorable OS in PC patients [PMC7943273]. Hsa-mir-5193 has been reported to inhibit the expression of TRIM11, leading to better OS in prostate cancer and suppression of HBV replication [PMC7943273]. Hsa-mir-5193 and hsa-miR-1343-3p have been verified to negatively correlate with DUOX2 through linear regression analysis [PMC7943273]. The miRNA targets shared between hsa_circ_0089761 and hsa_circ_0089761 include hsa-mir-5193, indicating their potential role in regulating gene expression [PMC9441041]. In a study comparing GLM vs. control groups, differential expression analysis revealed that hsa-mir-5193 was significantly upregulated [PMC9257833]. There are 43 co-targeting miRNAs, including hsa-mir-5193, which may have implications in cancer progression and development [PMC7607069].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUCCUCUACCUCAUCCCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications